Bot. Bull. Acad. Sin. (2001) 42: 231-241

Fu et al. — Patatin promoter-like sequence in Forever Young genes

Potato and tomato Forever Young genes contain class-I patatin promoter-like sequences

Hongyong Fu^1,*, Ji Du^2,4, Junqi Song³, Jiming Jiang³, and William D. Park^2,*

¹Institute of Botany, Academia Sinica, 128, Sec 2, Academy Rd., Nankang, Taipei, Taiwan 11529, Republic of China

²Department of Biochemistry and Biophysics, Texas A & M University, College Station, Texas 77843, USA

³Department of Horticulture, University of Wisconsin, Madison, Wisconsin 53706, USA

(Received December 21, 2000; Accepted July 3, 2001)

Abstract. Class-I patatin genes from potato, encoding the major storage protein in tubers, contain promoter repeat sequences, which are critical for developmental and metabolic regulation. Previously, RFLP mapping indicated the patatin genes of potato and tomato reside in orthologous loci near the end of the long arm of chromosome VIII. Interestingly, a DNA sequence homologous to the promoter of the potato class-I patatin gene was mapped to the middle of chromosome III in the tomato and potato genomes [Ganal et al., Mol. Gen. Genet. 225, 501-509 (1991)]. We isolated and characterized genomic clones containing the class-I Patatin Promoter-Like sequences (PPL) from tomato, S. bulbocastanum, and S. tuberosum. Sequence analyses reveal that these PPL sequences are highly conserved, as compared to the repeat sequence of the patatin promoter, particularly with respect to the critical regulatory cis-elements. These PPL sequences are located upstream of the translational initiation site of Forever Young genes, which encode proteins belonging to a large family of oxidoreductases with conserved structural motifs. The Forever Young genes from tomato and S. bulbocastanum both contain eight exons and seven introns. Six of the introns are uniquely large, in the range of 418~2,092 bp. Sequence conservation suggests that the class-I patatin repeat and the PPL from Forever Young genes may have a direct phylogenetic relationship and may regulate expression of their respective genes through common cis- and trans-factors.

Keywords: Forever Young; Oxidoreductase; Patatin; Potato; Promoter evolution; Tomato.

Introduction

Patatin is a family of glycoproteins that have lipid acyl hydrolase and transferase activities (Andrews et al., 1988) and account for up to 40% of the total soluble protein in potato tubers (Paiva et al., 1983). In potato, the patatins are encoded by a gene family with ~10-15 members per haploid genome. These genes can be divided in about equal numbers into two classes, class-I and class-II, based on the presence or absence of a 22-bp insertion in the 5´ UTR. Whereas these two classes of genes have conserved coding regions, the 5´ flanking sequences are highly diverged (Pikaard et al., 1987; Mignery et al., 1988). The class-I genes encode the majority of tuber patatins and have an essentially tuber-specific expression pattern

(Paiva et al., 1983). Besides being regulated developmentally, the class-I genes are also regulated by metabolic signal(s) derived from sucrose (Paiva et al., 1983; Rocha-Sosa et al., 1989; Wenzler et al., 1989; Jefferson et al., 1990). In contrast, patatins detected in roots and anther epidermal cells are primarily derived from class-II genes (Pikaard et al., 1987; Mignery et al., 1988). Unlike class-I genes, class-II genes are not sucrose-inducible (Köster-Töpfer et al., 1989; Liu et al., 1991).

Cis- and trans-factors responsible for developmental and metabolic regulation of the class-I patatin genes from potato have been examined extensively. An imperfect repeat in the 5´ region of the class-I patatin promoter contains separable cis-acting elements that are critical for "tuber-specific" and sucrose-inducible regulation. The sequence can be divided into two sub-regions (box A and box B), which are positioned from -552 to -514 and -626 to -592, respectively, for the distal repeat (in referring to the transcription start site as +1; Mignery et al., 1988). Motifs within these repeat sequences were found to interact with nuclear factors (Jefferson et al., 1990; Liu et al., 1990; Grierson et al., 1994).

Genetic and physical mapping analyses indicated the patatin genes show syntenic chromosomal organization in potato and tomato genomes and were mapped as a single cluster of loci near the end of the long arm of chromo

⁴Current address: Emory University, Atlanta, GA 30322, USA.

⁵The amino acid and nucleotide sequence data reported for S. bulbocastanum FEY, S. tuberosum FEY, Tomato FEY, and Arabidopsis FEY3, will appear in the GenBank, EMBL and DDBJ databases under the accession numbers AF216836, AF250031, AF216835 and AF217275, respectively.

*Corresponding authors. H. Fu, Tel: 886-2-27823050 ext 422, Fax: 886-2-27827954, E-mail: hongyong@gate.sinica.edu.tw; W.D. Park, Tel: 979-845-8868, Fax: 979-862-4471, E-mail: wdpark@tamu.edu

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

some VIII (Ganal et al., 1991). In these loci, patatin genes exist at ~10-15 and ~3 copies in potato and tomato, respectively. Whereas the chromosome VIII patatin loci in tomato contain only class-II genes, the orthologous potato loci have further evolved additional class-I genes. Interestingly, a DNA sequence homologous to the class-I patatin promoter was mapped to the middle of chromosome III in both the potato and tomato genomes. As tuber-bearing potato species, including the cultivated potato, are generally believed to have evolved recently (Hawkes, 1990), an interesting possibility arises that the PPL sequence was recruited from chromosome III during the evolution of class-I patatin genes located in chromosome VIII in potato.

To examine this hypothesis, we isolated and characterized genomic clones containing the class-I patatin promoter-like sequence from tomato, a tuber-bearing wild potato species Solanum bulbocastanum, and Solanum tuberosum. Sequences are highly conserved for these PPL-containing genomic clones, except for two relatively diverged regions, including one located immediately upstream of the PPL sequence. This indicates these genomic clones are indeed from orthologous loci. The patatin promoter-like sequence contains regions that are highly conserved compared to the critical regulatory sequences of potato class-I patatin genes. Interestingly, the PPL is located immediately upstream of a gene encoding Forever Young oxidoreductase (FEY). Our results support the hypothesis that the patatin repeat-like sequences in FEY genes have a direct phylogenetic relationship with the class-I patatin regulatory elements and that closely related cis- and trans-factors participate in regulating the expression of both FEY genes and class-I patatin genes.

Materials and Methods

Construction and Screening of the Tomato l-EMBL3 Genomic Library

The tomato genomic library was constructed using the l-EMBL3 vector (Stratagene, La Jolla, CA). Genomic DNA was isolated from young tomato leaves (cv. VFN-8) according to the method described by Rogers and Bendich (1988). DNA was partially digested with Sau3AI and was size-fractionated by centrifugation on a sucrose gradient (Sambrook et al., 1989). Ligation of fractionated DNA (~15 kb in length) into the BamHI site of the l vector and packaging were performed according to the manufacturer's instructions (Stratagene). Escherichia coli CES200 was used as the host for the recombinant l-EMBL3. Screening was performed as described by Sambrook et al. (1989) at reduced stringency (final washing at 60°C in 1 × SSC [0.1 M NaCl, 0.015 M sodium citrate]) by using a DNA fragment isolated from the class-I patatin promoter as a probe. The probe fragment is from -685 to -90 relative to the transcriptional start site of the patatin genomic clone pPS20 (Mignery et al., 1988). Polymerase chain reactions using the Vent polymerase (New England Biolabs, Beverly, MA) were performed to determine the sizes of upstream and

downstream sequences that flank the patatin-like region for the isolated tomato clones. For upstream sequence amplification, the primer pair of the oligonucleotides, tn2 and a lEMBL3 vector-specific primer of either lL or lR, was used. For downstream sequence amplification, tn1 and either lL or lR was used. The 4.1-kb overlapping genomic fragment from T05, which was used to append the final contiguous 11,472 bp sequence, was amplified by PCR using the primer pair, tn15 and lL, and the high fidelity pfuTurbo^TM DNA polymerase (Stratagene). The sequences from 5´ to 3´ for the oligonucleotides tn1, tn2, tn15, lR and lL are GTTACTGGTTCTACCAGCG
GTATCGG, CCGATACCGCTGGTAGAACCAGTAAC, CACATGTAAACCATTCCATATG, CAGCGCACATGG TACAGCAAG, and CATGGTGTCCGACTTATGCCC, respectively.

Isolation of PPL-Containing Genomic Clones from Potato

The potato BAC library was constructed as described by Song et al. (2000) using genomic DNA isolated from a diploid (2n=2x=24) potato species Solanum bulbocastanum (clone PT29, provided by Dr. J. P. Helgeson at the University of Wisconsin-Madison). The library consists of 23,808 clones with an average insert size of 155 kb in length and is equivalent to approximately 3.7 haploid potato genomes. Screening of the library was performed at reduced stringency (final washing at 65°C in 2 × SSC) using an ~8.0 kb DNA fragment as a probe, which was amplified by PCR from the tomato genomic clone T17 using oligonucleotide primers tn1 and lL (Figure 1A). Four positive clones, 2J8, 2O9, 4M6, and 31A14 were obtained from screening the complete BAC library. The PPL-containing genomic fragment from a cultivated potato species Solanum tuberosum (cultivar Russet Burbank) was isolated by PCR using high fidelity pfuTurbo^TM DNA polymerase and oligonucleotide primer pairs, which have sequences perfectly matched with the genomic sequences of both tomato and S. bulbocastanum. The 5´ primer P5´ is located 3,731 and 3,006-bp, respectively, upstream of the initiation codon for FEY from S. bulbocastanum and tomato, and the 3´ primer P3´ is located 84-bp downstream of the FEY start codon (Figure 1B). The sequences for the oligonucleotides P5´ and P3´ are: ggAAGCTTACC TTGGATGTGAATGTGAAAATATACC and GACCgg ATccAACCATCCTCGTAACCATTCCATCCATCC, respectively.

DNA Sequence Analysis

The 11,472 bp tomato sequence was determined and appended from a 10,832 bp sequence from T17 and an immediate downstream 640 bp sequence derived from T05. The upstream 10,832-bp sequence corresponds to a HindIII to PstI region in T17 (Figure 1A). To determine the 10,832-bp upstream sequence, overlapping restricted fragments from the T17 l-clone were subcloned into pBluescript (Stratagene). To determine the immediate downstream 640 bp sequence, a ~4.1 kb fragment overlap

Fu et al. — Patatin promoter-like sequence in Forever Young genes

Figure 1. Genomic clones from tomato and potato containing patatin promoter-like sequences. (A) The restriction map of a tomato genomic fragment containing patatin promoter-like sequence. Three characterized overlapping l genomic clones are shown above the map. The mapped fragment was derived from clone T17 and T05. The locations for the analyzed restriction enzymes were not determined downstream of the most 3´ XbaI site. Sizes in kilobase of regions flanking the PPL sequences for three genomic clones were determined by PCR and are indicated by double arrow lines. Positions and orientations of the primer oligonucleotides used are indicated by named bent arrows. The rectangular hatched box shown below the map is the location of the probe used previously for RFLP mapping (Ganal et al., 1991). ND, size is not determined. (B) The restriction map of a genomic fragment from S. bulbocastanum containing patatin promoter-like sequence. The fragment is appended from a ~23 kb PstI fragment and an overlapping 2.0 kb XbaI fragment isolated from a BAC genomic clone. The schematic graph of black boxes and lines below the map represents a PPL-containing genomic fragment isolated by PCR from Solanum tuberosum (lines indicate deletion as compared to S. bulbocastanum). Arrows designate position and orientation of oligonucleotide primers used in the amplification reaction, and the names of the primers are indicated. The solid black and gray boxes indicate regions that have or have not been sequenced, respectively. The regions that are highly homologous to the patatin regulatory sequence are indicated as open boxes. B, BamHI; E, EcoRI; H, HindIII; P, PstI; S, SalI; Ss, SstI; X, XbaI.

from 5´ to 3´ for the oligonucleotides AtFEY5´ and AtFEY3´ are AG[cAtATG]AGTGACGAAACGACGTCATCTCC and TT[Gagctc]CTATTCGTGTTGTGCTCCATACCGGCATTG, respectively. Lower case-letters are mutated bases for engineering restriction sites to facilitate subsequent cloning. Bases in brackets are the engineered NdeI and SacI site, respectively.

Results

Isolation of Tomato Genomic Clones Containing a Patatin Promoter-Like Sequence

We first screened for PPL-containing genomic clones from a tomato l-EMBL3 library (1.0 × 10⁶ plaque-forming units). Nine tomato genomic clones (including T01, T03-05, T07-08, T15-17) were isolated using a DNA probe derived from the promoter of a potato class-I patatin gene (pPS20; Mignery et al., 1988). The DNA probe contained both distal and proximal repeat sequences, critical for developmental and metabolic regulation of the patatin genes (Jefferson et al., 1990; Liu et al., 1990; Grierson et al., 1994). Results from restriction and sequencing analyses indicated that the isolated clones are overlapping and likely come from the same genetic locus (Figure 1A and data not shown). To select tomato clones for sequence analysis, PCR reactions were performed to determine the lengths of

ping with T17 was obtained from T05 by PCR using tn15 and lL as primers as well as the high fidelity pfuTurbo^TM polymerase (Stratagene) and subcloned into pBluescript. A 1,612 bp sequence, which had an overlapped 972 bp region identical to T17, was determined for the ~4.1 kb fragment from T05. To determine the 12,755-bp potato sequence, the overlapping restricted fragments from the BAC clone 31A14 were cloned into pBluescript. The 2,646-bp PPL-containing genomic fragment from S. tuberosum was cloned into pGEM-T vector (Promega, Madison, WI). Sequences of both strands for each of the subcloned fragments were determined by primer walking using the dideoxy chain termination method and an automated DNA sequencer (ABI 373, Applied Biosystems, Foster City, CA) according to the manufacturer's instruction. Sequence assembly and analyses were performed using programs from the University of Wisconsin Genetics Computer Group (UW-GCG) software package (Deveraux et al., 1984).

Isolation of Arabidopsis Forever Young cDNA

The Arabidopsis Forever Young cDNA was isolated from a flower cDNA library (Lansberg erecta; ABRC stock number CD4-6) by PCR using the primers, AtFEY5´ and AtFEY3´ as well as the high fidelity pfuTurbo^TM polymerase (Stratagene). The sequence for the Arabidopsis cDNA was determined by primer walking. The sequences

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

fragment was subsequently isolated by PCR from S. tuberosum, and its sequence was determined (Figure 1B).

PPLs are Highly Homologous to the Class-I Patatin Regulatory Sequences

The isolated genomic clones from tomato, S. bulbocastanum and S. tuberosum contain sequence regions of 250-, 234-, and 247-bp, respectively, which are highly homologous to a 160-bp region (the distal repeat) in the potato class-I patatin promoter (Figure 2A). Relative to the first base of the patatin translation initiation codon, the conserved region in class-I promoters is located between position -642 and -483. This region contains two short sequences (box B and A, underlined in Figure 2A), which also exist as an imperfect repeat (proximal repeat) between -269 and -195 (Bevan et al., 1986; Mignery et al., 1988). The two repeat sequences in the class-I patatin promoter were shown previously to be critical for developmental and metabolic regulation (Jefferson et al., 1990; Liu et al., 1990; Grierson et al., 1994). As described by Grierson et al. (1994), these repeats contain sequences that bind to nuclear factors (BBBF and BABF for Box B Binding Factor and Box A Binding Factor, respectively), and contain critical sequences for responding to sucrose induction (SURF for Sucrose Responsive Factor) (Figure 2A).

The PPL sequences have been divided into six sub-regions (I to VI), with regions III and V representing sequences not found in the 160-bp region of the class-I patatin promoter sequence. The sequence identity of PPL and the patatin promoter averages 93% when gaps are excluded for calculation and is 61% with gap residues in

sequences flanking the PPL sequence. Results for three genomic clones are shown in Figure 1A. The T17 clone has large 5´ and 3´ flanking regions, relative to the patatin promoter-like region, of 10 kb and 8 kb in length, respectively. In contrast, the T01 contains only ~2.5 kb 3´ flanking sequence, and the T05 contains only ~2.5 kb 5´ flanking sequence. To determine the patatin promoter-like sequence and to identify a possible adjacent gene, a contiguous 11,472 bp sequence was determined from T17 and T05. In this sequence, the 5´ 10,832-bp and the 3´ 640-bp were derived from T17 and T05, respectively.

Isolation of Potato Genomic Clones Containing the Patatin Promoter-Like Sequence

We isolated orthologous genomic clones from a diploid wild potato species, Solanum bulbocastanum, by screening a BAC genomic library using an 8 kb DNA probe derived from tomato T17 l-clone. Four positive clones were obtained from screening a total of 23,808 clones with an average insert size of 155 kb, which are equivalent to approximately 3.7 haploid potato genomes (Song et al., 2000). One of the clones, 31A14, was further examined by DNA blot analysis to identify a ~23 kb PstI fragment that cross-hybridized with the T17 probe. As shown in Figure 1B, the restriction map for the BAC clone 31A14 was partially determined, which includes the 23-kb PstI fragment and a downstream overlapping 2.0-kb XbaI fragment. To determine the patatin promoter-like sequence and to identify a possible adjacent gene, the sequence of a 12,755-bp region was determined for the assembled PstI-XbaI fragment of 31A14 (Figure 1B). A 2,646 bp PPL-containing genomic

Figure 2. Comparison between patatin and the patatin promoter-like sequences. (A) Alignment of the class-I patatin 5´ region and patatin promoter-like sequences. The aligned sequences are sub-divided into six regions indicated as I through VI. The coordinates are referred to the translational initiation codons for either patatin or an adjacent gene containing the patatin promoter-like sequences (see below). The repeat boxes B and A are indicated by a double-line and a thick line, respectively (Bevan et al., 1986). Sequences involved in nuclear factor binding are indicated by brackets with arrows. Letters in reverse type are identical bases. BBBF, Box B Binding Factor; BABF, Box A Binding Factor; SURF, Sucrose Responsive Factor. Patatin_D and Patatin_P indicate the distal and proximal repeat sequences of the class-I patatin promoter, respectively. S. tub., Solanum tuberosum; S. bul., Solanum bulbocastanum. (B) A phylogram showing the sequence similarity among the patatin and patatin promoter-like sequences. The phylogram was generated by the UW-GCG computer programs Paupsearch and Paupdisplay, using the bootstrap analysis option. Sequence similarities between distal and proximal patatin repeats, among PPL sequences, are indicated to the right. Sequence similarity of the distal and proximal patatin repeat as compared to the PPL sequences are indicated to the left. Values indicate percent nucleotide identity when gap residues are excluded or included (in parentheses) for calculation.

Fu et al. — Patatin promoter-like sequence in Forever Young genes

cluded (Figure 2). Cis-elements for BBBF and SURF binding are highly conserved in the patatin promoter-like sequences although sequences for BABF binding are interrupted by insertion of region III (Figure 2A). An insertion of 11-bp or a deletion of 7-bp was also found in the distal SURF binding site for the PPL sequences from tomato and S. tuberosum, respectively. In addition to the homology of the patatin repeat sequence (box B and box A), adjacent sequences are also highly conserved as compared to the 160-bp patatin sequence (5´ part of region I, regions II and VI).

As shown in Figure 2B, phylogenetic analysis revealed that the patatin promoter-like sequences from tomato, S. bulbocastanum and S. tuberosum are more similar to one another than to either the 160-bp distal or the 75-bp proximal repeat from the potato class-I patatin promoter. The patatin promoter-like sequences average 94.1% identity when gap residues are excluded from calculation and 83.5 % identity when gap residues are included. In contrast, when compared to the distal 160-bp patatin repeat, the patatin promoter-like sequences average only 61.0% identity when gap residues are calculated and 93.1% identity when gap residues are excluded. Also, comparisons with the proximal 75-bp patatin repeat show the patatin promoter-like sequences average only 39.2% identity when gap residues are calculated and 90.8% when excluded.

Sequence Comparison of PPL-Containing Loci from Tomato, S. bulbocastanum, and S. tuberosum

Sequence similarity of the genomic regions containing the patatin promoter-like sequence from the S. bulbocastanum and tomato was analyzed by the dot-plot method. The 12,755-bp sequence, which is from HindIII to XbaI (Figure 1B), from S. bulbocastanum was compared to a corresponding region from the tomato genomic clone. As shown in Figure 3, the two sequences are highly similar. When gap residues are not included in the calculation, the two sequences are 91.3% identical. Only two regions show no sequence similarity. Interestingly, the 5´ dissimilar region is located immediately upstream of the patatin promoter-like sequence. The 3´ dissimilar region is primarily due to a ~700-bp insertion existing in the potato sequence. This insertion contains a 132-bp sequence that is highly homologous to tomato SINE transposable elements (SINE1-3) located in a gene encoding farnesyl-protein transferase b subunit (Rebatchouk and Narita, 1997). The 132-bp sequence is flanked by 15-bp direct repeats, which likely represent the duplicated target site. The insertion in the S. bulbocastanum sequence is located in the sixth intron of an adjacent gene (see below).

The 2,646-bp PPL-containing genomic fragment from S. tuberosum is also highly homologous to the genomic clones from both tomato and S. bulbocastanum. Compared to the PPL-containing genomic clone of S. bulbocastanum, the genomic fragment from S. tuberosum is 93.1% identical when the gap residues are excluded for calculation and is 60.9% identical when gap residues are

Figure 3. Sequence comparison of genomic sequences containing the patatin promoter-like sequence from S. bulbocastanum and tomato. Sequence similarity of corresponding genomic regions containing the patatin promoter-like sequence from S. bulbocastanum and tomato were analyzed by a dot-plot matrix using window and stringency of 21 and 18 residues, respectively. The 12,755 bp sequence of S. bulbocastanum (from HindIII to XbaI) was compared to a corresponding 11,228 bp region (also from HindIII to XbaI) from the tomato sequence.

included. The two sequences have co-linear sequence similarity except for two large deletions (364-bp and 785-bp) that exist upstream of the PPL in the S. tuberosum genomic fragment. When compared to the tomato PPL-containing genomic clone, the genomic fragment from S. tuberosum is 87.8% identical when the gap residues are excluded for calculation and is 65.1% identical when gap residues are included. The region of least similarity between the tomato and S. tuberosum genomic sequences is also immediately upstream of the PPL.

High sequence similarity indicates that the PPL-containing genomic clones from tomato, S. bulbocastanum, and S. tuberosum are indeed from orthologous loci. In agreement, the PPL sequence was confirmed to be located in chromosome III by fluorescent in situ hybridization (data not shown) as predicted by previous RFLP mapping in both tomato and potato (Ganal et al., 1991).

The Patatin Promoter-Like Sequences Reside Next to the Forever Young Coding Sequence

The patatin promoter-like sequences from tomato, S. bulbocastanum, and S. tuberosum, may regulate expression of an adjacent gene. To identify the adjacent gene, the genomic sequences from potato and tomato were searched against the databases. The search identified closely related cDNA and genomic sequences from rice, Medicago truncatula, and Arabidopsis, which encode an oxidoreductase gene, designated as Forever Young, FEY (Callos et al., 1994; Wilson and Cooper, 1994). The FEY cDNAs from rice and Medicago were truncated at the 5´ end. Furthermore, the sequence of the only likely full-length FEY cDNA from Arabidopsis (designated here as

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

Figure 5. Exon and intron organization of FEY genes from S. bulbocastanum, tomato, and Arabidopsis. Exons and introns of Forever Young genes from S. bulbocastanum, tomato and Arabidopsis are drawn schematically to scale. Black boxes and lines indicate exons and introns, respectively. Numbers above or below corresponding exons and introns indicate lengths in bp. For the first and last exons, the lengths shown contain only the coding regions. The bar above the potato FEY indicates the position of the 132-bp SINE element.

AtFEY1; Callos et al., 1994) has a number of mismatched residues with two Arabidopsis Forever Young genomic sequences, designated here as AtFEY2 (Callos et al., 1994) and AtFEY3 (accession number, AL035602) from the same species. The primary concern is a single base pair deletion, which exists only in the Arabidopsis FEY1 cDNA but not in AtFEY2, AtFEY3 or any of the other characterized FEY genes from other species including rice, Medicago, tomato, S. bulbocastanum and S. tuberosum. A single base pair deletion was also found near the stop codon in AtFEY2. To clarify this, we isolated an apparently full-length Arabidopsis FEY3 cDNA from a flower cDNA library (Figure 4). The sequence of the Arabidopsis FEY3 cDNA is identical to the overlapped exons (exon 1 to 4) of the FEY3 genomic sequence. The designated translational initiation codon for the AtFEY3 cDNA is very likely to be correct because it is the nearest ATG immediately upstream of the conserved sequence in Arabidopsis FEY3 cDNA as compared to all other FEY sequences. In addition, an in frame stop codon was found immediately upstream of the putative start codon.

The junctions of all exons and introns for the potato and tomato FEY genes were easily identified, by comparing their sequences to that of the Arabidopsis AtFEY3 cDNA (Figure 5). Except for the last intron (intron 7), absent in Arabidopsis FEY2, the presence and location of all introns are completely conserved in FEY genes from tomato and S. bulbocastanum. Both sizes and sequences of the corresponding introns from S. bulbocastanum and tomato FEY genes are highly conserved. The only exception is the sixth intron of S. bulbocastanum, in which a ~0.7 kb insertion including a SINE element was found. The patatin promoter-like sequence is located 23-bp upstream of the translational initiation codon of the FEY genes from both tomato and S. bulbocastanum. Similarly, PPL in S. tuberosum also appears to reside 23-bp upstream of the Forever Young gene. The PPL-containing genomic fragment isolated from S. tuberosum contains most of the first exon of FEY gene and was found by PCR to have the rest

Figure 4. Nuceotide and deduced amino acid sequence of an Arabidopsis Forever Young cDNA, AtFEY3. The Arabidopsis FEY3 cDNA was isolated from a cDNA library by PCR using a high fidelity polymerase. Mismatched residues as compared to AtFEY1, AtFEY2 (Callos et al., 1994), or both are indicated by solid arrows, open arrows, and open arrow heads, respectively. The substituted bases or deletion (r) in AtFEY1 and AtFEY2 are indicated. The truncated positions of 5´ end for the rice and Medicago FEY cDNAs are indicated by arrows. Brackets with arrows indicate the wrong annotated start codons for the Arabidopsis FEY1 and FEY2 and for the Medicago FEY cDNA. The solid triangles indicate intron positions determined by comparison with a FEY genomic sequence (Callos et al., 1994).

Fu et al. — Patatin promoter-like sequence in Forever Young genes

of the FEY gene attached immediately downstream (data not shown).

High sequence conservation among the FEY genes from various species indicates these genes are likely homologs. As shown in Table 1, the FEY genes from tomato and S. bulbocastanum are 98.4% and 99.0% identical and similar in amino acid sequence, respectively. Also, the FEY genes from S. bulbocastanum and tomato are on average 75.7% and 82.4% identical and similar, respectively, when compared to the FEY genes from Arabidopsis, rice, and Medicago. In addition, FEY genes from Arabidopsis, Medicago and rice have an average of 71.5% and 80.0% sequence identity and similarity.

FEYs Belong to a Superfamily of Oxidoreductase Genes

A large set of sequences was identified from database searches for the derived amino acid sequences of FEY genes from both S. bulbocastanum and tomato. These sequences include protochlorophyllide oxidoreductases, alcohol dehydrogenases, ribitol dehydrogenases, and ketoreductases from various prokaryote and eukaryote species. Many of these sequences are derived from various genome projects. As shown in Figure 6, phylogenetic analyses place these sequences into distinct groups. Alignment analyses of a representative member from each branch identified six conserved structural motifs as shown in Figure 7. Five of these motifs are conserved with motifs of a known protein fingerprint designated as GDHRDH (for glucose/ribitol dehydrogenase; Yamada and Saier, 1987).

Figure 6. A phylogram showing the amino acid sequence relationships for a family of related oxidoreductases. A collection of related peptide sequences were identified from databases and analyzed by Paupsearch and Paupdisplay programs (UW-GCG). Abbreviations for species: Atha, Arabidopsis thaliana; Bnap, Brassica napus; Cele, Caenorhabditis elegans; Csat, Cucumis sativas; Hsap, Homo sapiens; Hvul, Hordeum vulgare; Lesc, Lycopersicon esculentum; Mlep, Mycobacterium tuberculosis; Mmus, Mus musculus; Mpal, Marchantia paleacea; Mtru, Medicago truncatula; Mtub, Mycobacterium tuberculosis; Osat, Oryza sativa; Pbor, Plectonema boryanum; Psat, Pisum sativum; Ptae, Pinus taeda; Sant, Streptomyces antibioticus; Scoe, Streptomyces coelicolor; Sliv, Streptomyces lividans; Speu, Streptomyces peucetius; Spom, Schizosaccharomyces pombe; Stre, Streptomyces; Sbul, Solanum bulbocastanum; Syne, Synechocystis; Taes, Triticum aestivum. Accession numbers for the analyzed sequences: Atha F17A8.100, CAB38642; Atha FEY, AF217275; Atha POR1-1, P21218; Atha POR1-2, AAC49043; Atha POR2, AAB97702; Atha RID1, AAC23625; Atha RID2, AAB63619; Atha RID3, CAA20464; Bnap RID1, S42651; Cele C01G8.3, AAB37640; Cele C15H11, CAB02732; Cele DC2; AAD14726; Cele E04F6, AAA68362; Cele K10H10.3, CAB05779; Cele K10H10.6, CAB05784; Csat POR, S20941; Hsap CGI-82, AAD34077; Hvul POR, P13653; Lesc FEY, AF216835; Mlep, RVMLCB1450.07, CAA16249; Mmus UBE-1b, BAA82657; Mpal POR, BAA31693; Mtru FEY, L22766; Mtub RV0068, CAA16249; Mtub RV0303, CAB09592; Mtub RV0439c, CAA17396; Mtub RV2263, CAA17300; Osat FEY, AF093628; Osat RID2, BAA83360; Pbor POR, BAA25993; Psat POR, S20941; Ptae POR, S30169; Sant Q03326, Q03326; Scoe SCJ9A.14, CAB53275; Scoe SCJ9A.19c, CAB53280; Sliv S19842, S19842; Speu dnrU, AAD04717; Spom SPCC736.13, CAA19277; Stre sp. C5 U43704.1, AAB08016; Sbul FEY, AF216836; Syne sp. PCC6803 POR, BAA10580; Taes POR, S39394.

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

Figure 7. Alignment of amino acid sequences of a family of related oxidoreduactases. The amino acid sequences of FEY gene from S. bulbocastanum (Sbul FEY) are aligned with sequences of a representative member from each branch of the family of the oxidoreductase genes (Figure 6). The six conserved regions identified are underlined and indicated as motifs I through VI. The first five regions contain subsequences, which correspond to the first five elements of a previously identified protein fingerprint named GDHRDH (Yamada and Saier, 1987) specified by double lines. The right border of motif II includes a highly conserved NNAGI sequence. The Tyrosine residue in YXXXK of motif IV is important for subunit binding. Motif I contains critical residues, which may be involved in binding to the cofactor NADPH (Armstrong et al., 1995). Species abbreviation and accession numbers for the aligned sequences are the same as in Figure 6.

Fu et al. — Patatin promoter-like sequence in Forever Young genes

Discussion

The class-I patatin genes produce approximately 40% of the total protein in potato tubers, but are not normally expressed in other tissues. Since most close relatives of potatoes, such as tomato and pepper, do not have tubers, the evolution of the "tuber-specific" class-I patatin genes represents a very interesting biological question. A high degree of synteny has previously been shown between the chromosomes of potato and tomato and that all of the patatin coding sequences in both species map to a single region near the end of chromosome VIII (Ganal et al., 1991). This same region also contains class-II patatin promoter sequences in both tomato and potato. However, the location for the sequence homologous to the class-I promoter differs. In potato, sequences homologous to class-I patatin promoters mapped to the end of chromosome VIII at the same locus as patatin structural genes, as expected. However, sequences homologous to class-I patatin promoter (PPL) also mapped near the middle of chromosome III to a locus that lacked patatin structural genes. In tomato, sequences homologous to the class-I patatin promoter were found only at the corresponding locus on chromosome III. An interesting possibility is that PPL sequences on chromosome III involved in the regulation of other genes were duplicated and recruited during the evolution of the class-I patatin genes in potato. To examine this, we have isolated and characterized genomic clones containing patatin promoter-like sequences from tomato, S. bulbocastanum, and S. tuberosum. Fluorescent in situ hybridization (data not shown) confirmed the chromosome III location of the PPL sequences in potato. We found that the PPL sequences are highly conserved with the critical regulatory sequences of the class-I patatin genes from potato. The PPL sequences reside upstream of Forever Young genes, which share high sequence similarity to a large set of sequences encoding oxidoreductases, including protochlorophyllide oxidoreductase (e.g., Armstrong et al., 1995). Sequence conservation suggests the class-I patatin promoter and the PPL sequence have a direct phylogenetic relationship. In addition, the PPL may regulate expression of Forever Young through common cis- and trans-factors with the class-I patatin genes.

Since it is generally believed that the evolution of tuber-bearing potato species is a relatively recent event (Hawkes, 1990), the tuber-specific and sucrose-inducible class-I patatin genes are also likely to have evolved recently. Recruitment of the critical repeat sequences, which exist in 1-3 copies in characterized class-I patatin genes, is likely an important step during the evolution of the tuber-specific patatin genes. Phylogenetic analyses show that the PPL sequences located in FEY genes from tomato, S. bulbocastanum, and S. tuberosum are more similar to one another than to the critical repeat sequences in class-I patatin genes from potato. This indicates a duplication event of the ancestor sequence for PPL, and the class-I patatin repeat likely occurred before the separation of potato and tomato. The PPL locus may actually be the direct descendant of the ancestral sequence. A duplicated

sequence for the class-I patatin repeat may have been derived from this locus. Interestingly, the sequence immediately upstream of the patatin promoter-like sequence is actually one of the two most diverged regions between the potato and tomato FEY genes. Furthermore, the second most diverged region in FEY genes contains a SINE transposable element (Figure 3 and 5).

The patatin promoter-like sequences in tomato, S. bulbocastanum, and S. tuberosum are located immediate upstream of sequences highly homologous to genes encoding Forever Young oxidoreductase from Arabidopsis, rice, and Medicago truncatula (Callos et al., 1994; Wilson and Cooper, 1994). High-level sequence similarity strongly indicates the tomato and S. bulbocastanum sequences encode FEY homologs and may be able to carry out a similar reduction reaction on unknown but specific substrate(s) in vivo. In Arabidopsis, interruption of FEY gene by a T-DNA insertion caused defects in development of shoot apical meristem (Callos et al., 1994). The in vivo substrate(s) of Forever Young reductase thus may play an important function in shoot meristem development. The related sequences and the conserved structural motifs identified (Figure 6 and 7) are likely to provide clues for future identification of the in vivo substrates for the Forever Young reductase.

Many of the sequence elements in the class-I patatin promoter, which are critical for binding to nuclear factors and for developmental and metabolic responses (Grierson et al., 1994), are conserved in the patatin promoter-like sequence of the FEY genes from tomato, S. bulbocastanum, and S. tuberosum. These include the two sub-repeat sequences, box A and box B, in class-I patatin promoter and the adjacent sequences (regions I, II, IV, and VI; Figure 2A), which contain many cis-elements with binding activities for nuclear factors. However, unique insertion sequences exist in the patatin promoter-like sequences (region III and V). The identification of conserved cis-elements in the PPL sequences from FEY genes suggests that these conserved sequences may mediate expression of the FEY genes through closely related transcription factors like the class-I patatin genes. However, a few regions in the PPL sequence, corresponding to cis-elements of class-I patatin promoter, are interrupted by insertion or deletion. The expected combinatorial action of these sequences and associated trans-factors may ultimately yield a different expression pattern for the FEY genes as compared to the class-I patatin genes in potato.

The class-I patatin promoter-like sequences in FEY genes from tomato, S. bulbocastanum, and S. tuberosum are located 23-bp immediately upstream of the translational initiation codon and very likely reside in the 5´ UTR regions. Alternatively, the sequence may reside in a leader intron located in the 5´ UTR. Important regulatory sequences located in regions other than 5´ flanking regions such as exons, introns, or 3´ flanking regions are not without precedents (e.g., Larkin et al., 1993; Fu et al., 1995a,b; Dickey et al., 1998). To address the actual functions of the PPL sequences, we have initiated cis-element shuf

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

fling experiments between class-I patatin repeat sequences and the Forever Young PPL sequences using promoter-reporter gene fusion and transgenic approaches.

Acknowledgements. This work was supported by funds from the National Science and Technology Program for Agricultural Biotechnology from Academia Sinica and the National Science Council (8905A02), from a U. S. Department of Agriculture Competitive Grant No. 92-37301-7788, and from a Heritage Prize to H.F from the Li Foundation, CA, USA. We thank Mingchu Lee, Clarissa Hew, Yenfen Lee, and Yun-Chi Tang for technical support and Dr. Charles M. Papa for his critical reading of this manuscript.

Literature Cited

Andrews, D.L., B. Beames, M.D. Summers, and W.D. Park. 1988. Characterization of the lipid acyl hydrolase activity of the major potato (Solanum tuberosum) tuber protein, patatin, by cloning and abundant expression in a baculovirus vector. Biochem. J. 252: 199-206.

Armstrong, G.A., S. Runge, G. Frick, U. Sperling, and K. Apel. 1995. Identification of NADPH:protochlorophyllide oxidoreductase A and B: A branched pathway for light-dependent chlorophyll biosynthesis in Arabidopsis thaliana. Plant Physiol. 108: 1505-1517.

Bevan, M.W., R. Barker, A. Goldsbrough, M. Jarvis, T. Kavanagh, and G. Iturriaga. 1986. The structure and transcription start site of a major potato tuber protein gene. Nucl. Acids. Res. 14: 4625-4638.

Callos, J.D., M. DiRado, B. Xu, F.J. Behringer, B.M. Link, and J.I. Medford. 1994. The forever young gene encodes an oxidoreductase required for proper development of the Arabidopsis vegetative shoot apex. Plant J. 6: 835-847.

Deveraux, J., P. Haberberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387-395.

Dickey, L.F., M.E. Petracek, T.T. Nguyen, E.R. Hansen, and W.F. Thompson. 1998. Light regulation of Fed-1 mRNA requires an element in the 5´ untranslated region and correlates with differential polyribosome association. Plant Cell 10: 475-484.

Fu, H., S. Kim, and W.D. Park. 1995a. High-level tuber expression and sucrose inducibility of a potato Sus4 sucrose synthase gene require 5´ and 3´ flanking sequences and the leader intron. Plant Cell 7: 1387-1394.

Fu, H., S. Kim, and W.D. Park. 1995b. A potato Sus3 sucrose synthase gene contains a context-dependent 3´ element and a leader intron with both positive and negative tissue-specific effects. Plant Cell 7: 1395-1403.

Ganal, M., M.W. Bonierbale, M.S. Roeder, W.D. Park, and S.D. Tanksley. 1991. Genetic and physical mapping of the patatin genes in potato and tomato. Mol. Gen. Genet. 225: 501-509.

Grierson, C., J.-S. Du, M.T. Zabala, K. Beggs, C. Smith, M. Holdsworth, and M. Bevan. 1994. Separate cis sequences and trans factors direct metabolic and developmental regulation of a potato tuber storage protein gene. Plant J. 5: 815-826.

Hawkes, J.G. 1990. The Potato: Evolution, Biodiversity, and Genetics Resources. Smithsonian Institution Press, Washington, D.C.

Jefferson, R., A. Goldsbrough, and M. Bevan. 1990. Transcriptional regulation of a patatin-I gene in potato. Plant Mol. Biol. 14: 995-1006.

Köster-Töpfer M., W.B. Frommer, M. Rocha-Sosa, S. Rosahl, J. Schell, and L. Willmitzer. 1989. A class II patatin promoter is under developmental control in both transgenic potato and tobacco plants. Mol. Gen. Genet. 219: 390-396.

Larkin, J.C., D.G. Oppenheimer, S. Pollock, and M.D. Marks. 1993. Arabidopsis GLABROUS1 gene requires downstream sequences for function. Plant Cell 5: 1739-1748.

Liu, X.J., S. Prat, L. Willmitzer, and W.B. Frommer. 1990. Cis regulatory elements directing tuber-specific and sucrose-inducible expression of a chimeric class I patatin promoter/GUS-gene fusion. Mol. Gen. Genet. 223: 401-406.

Liu, X.-J., M. Rocha-Sosa, S. Hummel, L. Willmitzer, and W.B. Frommer. 1991. A detail study of the regulation and evolution of the two classes of patatin genes in Solanum tuberosum L. Plant Mol. Biol. 17: 1139-1154.

Mignery, G.A., C.S. Pikaard, and W.D. Park. 1988. Molecular characterization of the patatin multigene family of potato. Gene 62: 27-44.

Paiva, E.P., R.M. Lister, and W.D. Park. 1983. Induction and accumulation of the major potato tuber protein, patatin. Plant Physiol. 71: 161-168.

Pikaard, C.S., J.S. Brusca, D.J. Hannapel, and W.D. Park. 1987. The two classes of genes for the major tuber protein, patatin, are differentially expressed in tubers and roots. Nucleic Acids Res. 15: 1979-1994.

Rebatchouk, D. and J.O. Narita. 1997. Foldback transposable elements in plants. Plant Mol. Biol. 34: 831-835.

Rocha-Sosa, M., U. Sonnewald, W. Frommer, M. Stratmann, J. Schell, and L. Willmitzer. 1989. Both developmental and metabolic signals activate the promoter of a class I patatin gene. EMBL J. 8: 23-29.

Rogers, S. and A.J. Bendich. 1988. Extraction of DNA from plant tissues. In S.B. Gelvin, D.P.S. Verma and R.A. Schilperoort (eds.), Plant Molecular Biology Manual, Kluwer Academic Publishers, Dordrecht, pp. A6:1-10.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

Song, J., F. Dong, and J. Jiang. 2000. Construction of a bacterial artificial chromosome library for potato molecular cytogenetics research. Genome 43: 199-204.

Wenzler, H.C., G.A. Mignery, L.M. Fisher, and W.D. Park. 1989. Analysis of a chimeric class I patatin-GUS gene in transgenic potato plants: high level expression in tubers and sucrose-inducible expression in cultured leaf and stem explants. Plant Mol. Biol. 12: 41-50.

Wilson, R.C. and J.B. Cooper. 1994. A nodulin cDNA with homology to protochlorophyllide reductase. Plant Physiol. 104: 289-290.

Yamada, M. and M.H. Saier. 1987. Glucitol-specific enzymes of the phosphotransferase system in E. coli- Nucleotide sequence of the GUT operon. J. Biol. Chem. 262: 5455-5463.

Fu et al. — Patatin promoter-like sequence in Forever Young genes