pg_0001

Botanical Studies (2007) 48: 13-23.

Corresponding author: E-mail: songwq@nankai.edu.cn:

Phone: 086-022-23508241; Fax: 086-022-23497010.

INTRODUCTION

RNA editing is a phenomenon which occurs widely

in very diverse groups of eukaryotes. It modifies the

genetic information at the post-transcriptional level by

exchanging, inserting or deleting standard nucleotides

of the genetic alphabet (Benne, 1996; Smith et al., 1997;

Maier et al., 1996; Steinhauser et al., 1999). In higher-

plant mitochondrial RNAs, this process is characterized

by C-to-U, and more rarely U-to-C, exchanges. When

editing occurs in coding regions, it is found to generate

translational start codons by ACG to AUG conversions,

as in nad1 transcripts in wheat and coxI transcripts in

tomato (Hoch et al., 1991; Kudla et al., 1992; Chapdelaine

and Bonen, 1991; Kadowaki et al., 1995) or remove the

translational stop codons such as in atp6, atp9 and rps10

transcripts in several plant species (Wakasugi et al.,

1996; Yoshinaga et al., 1996; Wintz and Hanson, 1991;

Kempken et al., 1991; Zanlungo et al., 1995). However,

the editing sites are mainly in the first or second positions,

and the corresponding amino acids are usually altered,

which improves the conservation of predicted protein as

compared to other organisms, such as animals and fungi

(Kurek et al., 1997; Bock, 2000). In rare cases, the editing

events are observed at the third positions, and thus do not

result in amino acid changes, a phenomenon that has been

termed silent editing. In the mitochondria of Arabidopsis,

51 such sites have being identified, summing up to 11.6%

of the total 441 sites identified in coding regions (Giege

and Brennicke, 1999). In other cases, some RNA editing

sites are also found outside of the protein-coding regions.

The site, 32nt upstream of psbF i n Ginkgo biloba, is

edited (Kudla and Bock, 1999). Such RNA sites were

also detected in the 5ЁІ untranslated regions of maize and

rice ndhG mRNAs (Corneille et al., 2000). Moreover,

the editing of "structural" RNAs has been described. In

RNA editing analysis of mitochondrial nad3/rps12 genes

in cytoplasmic male sterility and male-fertile cauliflower

(Brassica oleracea var. botrytis) by cDNA-SSCP

Chunguo WANG

, Xiaoqiang CHEN

, Hui LI

1,2

, and Wenqin SONG

College of Life Sciences, Nankai University, Tianjin, 300071, P.R. China

Department of Horticulture, Tianjin Agricultural University, Tianjin, 300384, P.R. China

(Received December 12, 2005; Accepted May 11, 2006)

ABSTRACT. Characteristics of mitochondrial nad3/rps12 locus have been shown to differ in cytoplasmic

male sterility (CMS) and male-fertile cauliflower (maintainer line of CMS cauliflower). However, nad3/rps12

can normally be co-transcribed in both lines. A specific fragment of about 800-bp has been detected by RT-

PCR analysis. In order to further elucidate whether these two genes undergo different post-transcriptional

modifications in the two lines, the RNA editing status of nad3/rps12 was analyzed by cDNA-SSCP (single-

strand conformation polymorphism). A total of 100 cDNA clones obtained from CMS and male-fertile

cauliflower, respectively, were investigated. In CMS cauliflower, nine RNA editing patterns were identified

while three were found in male-fertile cauliflower. To confirm the reliability of cDNA-SSCP analysis, four

clones, randomly selected from each pattern, were sequenced. In total, 20 RNA editing sites were detected

in the twelve different patterns, all within the coding region. In CMS cauliflower, except for the fact that one

site was fully edited and one site was pre-edited, the editing of other sites (18) was incomplete. In contrast,

in male-fertile cauliflower, 13 of the 20 sites were pre-edited; two sites were fully edited, and only five were

partially edited. These results suggested significant differences in the RNA editing status of nad3/rps12

between the two lines. Further phylogenetic tree analysis indicated that these genes belonged to different

branches. Our data suggested that, given the same nuclear background, and excluding the effects of various

growth conditions and developmental stages, the structure and origin of nad3/rps12 may be the main factors

affecting RNA editing status. Moreover, the relationship between the RNA editing status of nad3/rps12 and

the CMS trait in cauliflower is discussed.

Keywords: Cauliflower (Brassica oleracea var. botrytis); Cytoplasmic male sterility (CMS); RNA editing;

SSCP (single-strand conformation polymorphism).

MOLECULAR BIOLOGY

pg_0002

Botanical Studies, Vol. 48, 2007

Oenothera mitochondria, two editing sites were found

in a subpopulation of 26S rRNA molecules (Schuster et

al., 1991), the first report that RNA editing takes place

in ribosomal RNA. In physarum and dictyostelium

mitochondria, the RNA editing of "structural" RNAs, the

small subunit ribosomal RNAs (SSU rRNAs), was also

observed (Mahendran et al., 1994; Barth et al., 1999).

Although the function of RNA editing in these "structural"

rRNAs is still unclear, some evidence has indicated that

these editing events may be required for the formation of

correct structure, suggesting their importance to efficient,

accurate translation in the mitochondria (Barch et al.,

1999).

To date, more than 1000 RNA editing sites have been

found in all examined plant mitochondrial genes (Schuster

and Brennicke, 1994), almost all undergoing specific

post-transcriptional C-to-U conversion by RNA editing,

with the rare exception of a few genes in specific plants.

One of these is T-urf13 in T-CMS maize (Ward and

Levings, 1991), which is unique to the CMS-T cytoplasm

of maize (Dewey et al., 1986). Another is atp6 in radish

(Krishnasamy et al., 1994), the unedited transcripts of

which can produce proteins identical to those from edited

transcripts in other plants, implying that editing of this

gene in radish is unnecessary (Rankin et al., 1996).

Although RNA editing can be detected in a wide range

of plant mitochondrial genes, in some cases the editing

frequencies or editing patterns of certain genes are not

identical in different plants, nor are they always identical

in different tissues of the same plant, in plants of disparate

growth conditions or developmental stages. In maize

mitochondria, incompletely editing of nad3 transcripts

was detected in all tissues, while a temporal increase in

the overall editing status from 50% at 3 days to about 75%

at 7 days was also found (Grosskopf and Mulligan, 1996).

In euplasmic and alloplasmic cytoplasmic male sterility

wheat lines, the RNA editing of atp6 occurred in twelve

codons, all of which were fully edited in the euplasmic

Triticum timopheevi, while in the CMS lines 17% of the

clones were only partially edited. In atp9 transcripts, eight

codons were modified by RNA editing, and all eight were

found fully edited in embryos, roots, shoots, and anthers

in the euplasmic wheat lines, while in the transcripts

obtained from the CMS lines, 19% of the clones were

partially edited (Kurek et al., 1997). More interesting

examples can be found in some cytoplasmic male sterility

plants and their corresponding male-fertile materials,

which usually have different nuclear backgrounds. The

frequency of atp6 RNA editing was specifically reduced in

anthers of A3-CMS sorghum. However, it was increased

in partially restored progeny (Tang et al., 1999; Howad et

al., 1999; Pring et al., 1998). Similarly, the RNA editing of

orf107, which is associated with CMS trait in A3 sorghum,

has shown to be altered in leaf tissues of plants carrying

Rf3, a fertility restoration gene of A3-CMS sorghum.

While orf107 is highly edited in CMS line A3Tx398, the

lines carrying Rf3Rf3 or Rf3rf3 exhibit reduced editing in

the residual, non-processed transcripts (Pring et al., 1998).

In CMS rice, two different N-atp6 and B-atp6 transcripts

coexist, and the extent of RNA editing in the latter mRNAs

was affected in the processing controlled by a nuclear

gene involved in fertility restoration (Iwabuchi et al.,

1993). In S-CMS maize, the sequence of orf77 associated

with the CMS trait, was similar to that of atp9. Although

the atp9 transcripts were fully edited, orf77 nucleotides

corresponding to edited nucleotides in atp9 were either not

edited or edited inefficiently (Gallagher et al., 2002). One

explanation was that the editing sites in chimeric orf77

could cause male sterility by compromising the expression

of atp9. This evidence indicates that the RNA editing

and cytoplasmic male sterility, two important phenomena

associated with higher plant mitochondria, may have a

relationship, although some ambiguous problems still

require to be elucidated.

In previous study, we noticed that the characteristics

of nad3/rps12 locus were different in near-isogenic

cytoplasmic male sterility and male-fertile cauliflower.

To date, we have no further knowledge about these genes

in either line. Here, we conduct the transcription and

RNA editing analysis of nad3/rps12, which have been

reported in several plant species (Rankin et al., 1996;

Pesole et al., 1996; Itani and Handa, 1998; Wilson and

Hanson, 1996). The cDNA-SSCP method, together with

direct sequencing, was performed. The data indicated that

this method was capable of analyzing the RNA editing

of certain genes. Moreover, the origin of nad3/rps12 in

both lines was deduced by phylogenetic tree analysis. The

possible relationship between RNA editing status of these

genes and the CMS trait in cauliflower is also discussed.

MATERIALS AND METHODS

Plant materials

The CMS cauliflower, NKC-A and male-fertile

cauliflower, NKC-B (the maintainer line of NKC-A) were

kindly provided by Dr. Deling-Sun, Tianjin Vegetable

Research Institute, Tianjin, China and grown under

normal light conditions (day/light temperature of 25/19

ЂXC, 16 h photoperiod). NKC-A had been backcrossed for

twelve generations with the maintainer lines NKC-B, so

theoretically, both lines possessed an identical nuclear

background. The 10-day-old fresh leaves were used for

total DNA and RNA extraction.

DNA and RNA isolation

Total DNA was isolated using the CTAB method

(Murray and Thompson, 1980) with some modifications.

Fresh leaves (0.2 g) were ground in liquid nitrogen, and

the frozen power was then directly added to 2 mL lysis

buffer (100 mM Tris-HCl, pH 8.0, 50 mM EDTA, 1.4 M

NaCl, 0.2% Ѓ]-mercaptoethanol, 2% PVP and 1ЁбCTAB).

After incubation at 56ЂXC for 30 min, 2 mL phenol :

chloroform : isoamyl alcohol (25:24:1) was added. The

supernatant was obtained by centrifugation at 10,000 g

pg_0003

WANG et al. ЁX RNA editing analysis of

nad3/rps12

genes

for 10 min and extracted once with an equal volume of

chloroform : isoamyl alcohol (24:1). After centrifuging

at 11,000 g for 15 min, a two-thirds volume of cold

isopropanol was added to the supernatant. The mixture

was incubated for 30 min at -20ЂXC. DNA was pelleted by

centrifugation at 11,000 g for 30 min at 4ЂXC and dissolved

in 100 ЃgL TE (pH 8.0) buffer. After the RNA was digested

in the presence of 200 Ѓgg/ЃgL RNase A for 1 h at 37ЂXC, the

DNA was detected by 1.0% agarose gel in 0.5ЁбTBE and

stored at -20ЂXC.

Total RNA was isolated using TRIZOlR (BBI, Canada),

according to the manufacturer ЁІs instructions. After the

contaminated DNA was digested with DNase I (TaKaRa,

Japan) for 30 min at 37ЂXC, total RNA was tested by 1.2%

denaturing agarose gel and stored at -70ЂXC.

cDNA synthesis and PCR amplification

DNase I-treated total RNA (5 Ѓgg) were reverse

transcribed to cDNA using 0.2 Ѓgg reverse primer of nad3/

rps12, NR4, and 200 unit M-MLV reverse transcriptase

under conditions specified by the enzyme supplier

(Promega, USA) in a final volume of 10 ЃgL. Following

reverse transcription, PCR reactions were performed

following the program for initial denaturation at 94ЂXC for 2

min: 35 cycles of denaturation at 94ЂXC for 30 s, annealing

at 55ЂXC for 1 min, and extension at 72ЂXC for 1 min 15 s,

and a final extension at 72ЂXC for 8 min in a final volume

of 25 ЃgL containing 1 unit of Taq DNA polymerase

(TaKaRa, Japan), 10 mM Tris-HCl (pH 8.3), 50 mM KCl,

1.5 mM MgCl

, 200 ЃgM dNTPs, 0.2 ЃgM of each forward

and reverse primer, and about 50 ng of total DNA or 1 ЃgL

of the single-stranded reaction. After the amplification, the

PCR products were separated by electrophoresis on 1.5%

agarose gel. After being stained with ethidium bromide,

gel was photographed under ultraviolet light using the

GeneGenius (Syngene, USA). Oligonucleotide primers

used for cDNA synthesis and PCR amplification are listed

below. Primers ND1 and ND2 were designed to amplify

long sequences containing nad3/rps12 from total DNA.

Primers ND3 and ND4 were used to amplify nad3/rps12

from both total DNA and cDNA.

ND1: 5ЁІ AAGCGGGGTAGAGGAATTGGT 3ЁІ

ND2: 5ЁІ AGTTCCAGAGGCATCTTCCATTC 3ЁІ

ND3: 5ЁІ CAAAGTGGGCTGTAATGATGT 3ЁІ

ND4: 5ЁІ CATATCGATTTGGGTTTTTCTG 3ЁІ

Cloning of nad3/rps12 from DNA and cDNA

PCR products containing target sequences were

extracted with the QIAquick Gel Extraction Kit

(QIAGEN, USA), and were then directly cloned in

pUCm-T easy vectors (BBI, Canada) according to

the manufacturerЁІs instructions and transformed into

Escherichia coli DH5Ѓ\. Positive clones were identified by

the PCR method, and the PCR conditions were performed

as described above. The positive clones with the insertion

of nad3/rps12 and flank sequence were directly sequenced

by the ABI3730 sequencer (Applied Biosystems, USA).

Those positive clones with the insertion of nad3/rps12

coming from both cDNA and total DNA were, prior to

being sequenced, analyzed by the following cDNA-SSCP

method to detect the RNA editing status in CMS and male-

fertile cauliflower.

cDNA-SSCP analysis and sequencing

1 ЃgL samples of nad3/rps12 amplified from positive

clones were added to an equal volume of denaturing

loading buffer (95% formamide, 0.05% bromo phenolblue,

0.05% xylene cyanol FF, and 20 mM EDTA), denatured

at 97ЂXC for 8 min, and immediately placed on ice for

2 min. After loading on a neutral 6% polyacrylamide

gel (29:1, acryamide: bisacrylamide), the samples were

electrophoresed in 1ЁбTBE buffer at 20ЂXC and run at 120v

for 10-12 h. The gel then was stained with Silver Stain

Kit (ATTO, Japan). Based on the results of SSCP, four

clones randomly selected from each RNA editing pattern

were sequenced by the ABI3730 sequencer (Applied

Biosystems, USA). All the sequences were further

analyzed by the Clustal W program (Thompson et al.,

1994).

Phylogenetic tree analysis

The sequences of nad3/rps12 in other plant species,

obtained from the DNA database of NCBI, and the two

sequences in CMS and male-fertile cauliflower were

aligned by the Clustal W program, After that, an unrooted

neighbour-joining phylogenetic tree was constructed

using the Phylip3.63 software (http://evolution.genetics.

washington.edu/phylip.html) with the neighbor-joining

(NJ) method (Saitou and Nei, 1987). The reliability of the

tree was established by conducting 1000 neighbor-joining

bootstrap sampling steps (Felsenstein, 1985). Phylogenetic

trees were visualized using the Tree View, 1.6 program

(http://taxonomy.zoology.gla.ac.uk/rod/treeview.html).

RESULTS

The nad3/rps12 locus structure is different

between the two lines; however, the genes can

normally be co-transcribed

Previous research identified a 21nt reverse repeat in the

nad3/rps12 locus of CMS cauliflower NKC-A that was

not present in male-fertile cauliflower. In order to further

clarify whether the nad3/rps12 locus was different in CMS

and fertile cauliflower, specific primers (ND1 and ND4)

were designed to amplify the corresponding region of the

nad3/rps12 locus. A predicted fragment of approximately

2 kb was detected in CMS cauliflower NKC-A, but not

in male-fertile cauliflower (Figure 1). Further sequence

analysis revealed that this fragment contained nad3/rps12

genes, found both in CMS and fertile cauliflower, as well

as an unknown upstream region of nad3/rps12 that was

divergent in both lines (accession number: DQ219816,

DQ219817). This suggested that the structure of the nad3/

pg_0004

Botanical Studies, Vol. 48, 2007

rps12 locus in the corresponding 2 kb region is different.

Considering that structural differences may affect nad3/

rps12 expression, transcriptional analysis was performed.

However, no significant differences were noted, as

measured by RT-PCR. A specific cDNA fragment of nad3/

rps12 of about 800-bp was detected in both lines (Figure

2).

Different RNA editing patterns were detected by

cDNA-SSCP in the two lines

A total of 100 cDNA clones with nad3/rps12 insertion

obtained from CMS and male-fertile cauliflower,

respectively, were investigated. In CMS cauliflower

NKC-A, nine distinguishing RNA editing patterns

were identified, while three were found in male-fertile

cauliflower NKC-B (Figures 3 and 4). According to the

number of cDNA clones representing each RNA editing

pattern and the total number of cDNA clones (100)

detected in each line, the frequency of each RNA editing

pattern was calculated (Table 1). In CMS cauliflower

NKC-A, the frequency was 2% to 36%. However, in male-

fertile cauliflower NKC-B, the frequency was 28% to

42%. These results indicated that the RNA editing patterns

in CMS cauliflower NKC-A were more complex than

those in male-fertile cauliflower NKC-B.

RNA editing frequencies in corresponding sites

are also different in the two lines

To confirm the reliability of cDNA-SSCP analysis and

obtain further information regarding RNA editing sites,

four clones, randomly selected from each patternЁXexcept

pattern 7, from which only two clones were selectedЁX

were sequenced. Analysis of these sequences indicated that

the clones selected from the same RNA pattern exhibited

identical sequences. A total of 20 RNA editing sites were

detected within twelve different patterns (Figure 5), all

within the coding region. In CMS cauliflower NKC-A, 19

sites were C-to-U edited. 18 of these were incompletely

edited, and the one at position 5 was fully edited.

Interestingly, the RNA editing site at position 5 could be

detected in all nine RNA editing patterns, and another site

at position 605 was pre-edited. The editing frequency was

6% to 98%. In male-fertile cauliflower NKC-B, 13 of the

20 sites were pre-edited, with two sites at positions 80 and

Figure 1. PCR amplified products of the nad3/rps12 locus using

primers ND1 and ND4 in CMS and male-fertile cauliflower,

respectively. F : male-fertile cauliflower. S: cytoplasmic male

sterility cauliflower. M: molecular weight marker (100-bp

ladder).

Figure 2. PCR and RT-PCR analysis of the nad3/rps12 using

primers ND2 and ND3 in CMS and male-fertile cauliflower,

respectively. cF : RT-P CR amplified products of nad3/rps12

in male-fertile cauliflower. cS: RT-PCR amplified products of

nad3/rps12 in cytoplasmic male sterility cauliflower. F: PCR

amplified products of nad3/rps12 in male-fertile cauliflower. S:

PCR amplified products of nad3/rps12 in CMS cauliflower. M:

molecular weight marker (100-bp ladder).

Table 1. The frequency of RNA editing pattern detected by

cDNA-SSCP (Numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12

listed in the editing pattern column correspond with those in

Figure 3).

Editing

pattern

Frequency

(%)

Editing

pattern

Frequency

(%)

Editing

pattern

Frequency

(%)

10 42

11 30

12 28

pg_0005

WANG et al. ЁX RNA editing analysis of

nad3/rps12

genes

Figure 3. Different RNA editing patterns of nad3/rps12 in CMS

and male-fertile cauliflower, respectively, detected by cDNA-

SSCP. Lanes 1, 2, 3, 4, 5, 6, 7, 8 and 9 indicate different RNA

editing patterns of nad3/rps12 in CMS cauliflower. Lanes 10, 11

and 12 indicate different RNA editing patterns of nad3/rps12 in

male-fertile cauliflower. Prior to the analysis of cDNA-SS CP,

the corresponding cDNA clones were firstly detected by agarose

gel.

Figure 4. Distribution of RNA editing sites of nad3/rps12 in

each RNA editing pattern detected by cDNA-SSCP. Numbers

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 corres pond with those

in Figure 3. Drawing is approximately to scale, with C-to-U

edits shown as vertical lines and those pre-edited sites shown

as vertical broken lines (CMS cau.= CMS cauliflower; Fertile

cau.= Fertilie cauliflower).

Figure 5. Organization and sequence of the nad3/rps12 locus in CMS cauliflower. The genes of trnfM, nad3 and rps12 are indicated

by black boxes. The repeat sequences found in this sequence were indicated by shaded boxes. Horizontal arrows showed the positions

of primers used in reverse transcription (ND4) and PCR amplification experiments (ND1, ND2, ND3 and ND4). The sequence of

nad3/rps12 was shown in triplets. RNA editing sites (corresponding C-to-U changes at mRNA level) are boxed, and the altered

nucleotides are italic and lowercase. The start and stop codons are marked by shadow following that. * indicates the corresponding

stop signal in amino acids level.

pg_0006

Botanical Studies, Vol. 48, 2007

605 fully edited and five sites, at positions 23, 61, 146,

208 and 209, also incomplete edited. However, the editing

frequency was from 30% to 72% (Table 2).

The origin and structure of nad3/rps12 may

be associated with the RNA editing status in

cauliflower

CMS and male-fertile cauliflower in this study

possess an almost identical nuclear background while

the RNA editing status of nad3/rps12 in these two lines

is significantly different. Excluding the effect of growth

conditions and developmental stages, it may result from

the genes themselves. The phylogenetic tree analysis

was performed. Besides the two DNA sequences of

nad3/rps12 from CMS and male-fertile cauliflower,

respectively, 21 other corresponding sequences from

different species were available in the NCBI database

(Table 3). The phylogenetic tree indicated that all these

species could be distinguished by sequences of nad3/

rps12 (Figure 6). The nad3/rps12 of CMS cauliflower

NKC-A had a phylogenetic distance similar to that of R.

sativus (accession numbers: U43506). The genes in male-

fertile cauliflower NKC-B, on the other hand, obviously

had a phylogenetic distance similar to that of B. napus

(accession numbers: AP006444). This result implied

that the origin of nad3/rps12 in CMS and male-fertile

cauliflower was different.

DISCUSSION

RNA editing, in higher plants, is essential to modifying

mitochondrial genes at the post-transcriptional level. It

affects not only the function genes, but also the structure

genes. Direct sequencing of several cDNA clones is

regarded as an ideal method of studying the RNA editing

status of certain genes. However, in some cases, the

balance between the sequencing cost and the accuracy

must be considered. Here, we establish a method, cDNA-

SSCP (single-strand conformation polymorphism), and

combine it with direct sequencing to investigate the RNA

editing status of nad3/rps12 in cauliflower, dramatically

reducing the cost without compromising accuracy. SSCP

analysis depends on the conformation change of single-

strand DNA having nucleotide substitutions (Orita et

al., 1989; Nataraj et al., 1999). Because of the sensitive,

inexpensive, and comparatively fast nature of this

method, it has been widely used in detecting mutation

sites, and single nucleotide polymorphisms (SNP) and

in mapping and tracking candidate genes (Nataraj et al.,

1999; Slabaugh et al., 1997; Sato and Nishio, 2002).

C-to-U RNA editing in higher plant mitochondria can

also be regarded as a mutation at the mRNA level and

can, theoretically, be analyzed by SSCP. However, to

date, little research has been reported in this field, with

the exception of RNA editing of the ndhA gene in maize

Table 2. The RNA editing sites of nad3/rps12 and the editing frequency of each site in CMS and male-fertile cauliflower,

respectively. (cau.= cauliflower).

Editing position

Coden change

Residue change

Editing frequency

CMS cau. (%)

Fertile cau. (%)

TcA

S>L

100

Pre-edited

TcT

S>F

cTA

L (silent)

CcA

P>L

100

146

TcC

S>F

208

ccT

P>F

209

ccT

P>F

247

cCT

P>F

Pre-edited

251

CcC

P>F

Pre-edited

256

cTG

L (silent)

Pre-edited

344

TcG

S>L

Pre-edited

349

cGG

R>W

Pre-edited

508

CcG

P>L

Pre-edited

550

CcA

P>L

Pre-edited

600

cAC

H>Y

Pre-edited

605

AT t*

I>F

Pre-edited

100

625

TcG

S>L

Pre-edited

673

TcG

S>L

Pre-edited

689

TCc

S (silent)

Pre-edited

690

cAT

H>Y

Pre-edited

pg_0007

WANG et al. ЁX RNA editing analysis of

nad3/rps12

genes

(Fuchs et al., 2001). This may be due to the complexity

of the RNA editing status, which reduces the sensitivity

of SSCP analysis. In the present study, nad3/rps12 RT-

PCR products from CMS and male-fertile cauliflower,

respectively, were cloned. Each cDNA clone was then

analyzed by SSCP, a process termed cDNA-SSCP.

Because each cDNA clone represented only one status of

RNA editing, the RNA editing pattern was dramatically

simplified compared with the RT-PCR products directly

used as samples. In 200 detected cDNA clones, each can

produce distinguishable single-strand conformation. With

strict control of the electrophoresis conditions, sample

quantity and repeated experimentation (n=3/cDNA clone),

a total of 12 different RNA editing patterns were detected

(Figures 3 and 4). Random sequencing of four cDNA

clones from each detected pattern confirmed this result.

Our data demonstrated that SSCP analyzed the RNA

editing of nad3/rps12 of cauliflower nearly as efficiently

as direct sequencing. However, as mentioned above, the

complexity of the RNA editing in different genes, the

condition of the electrophoresis, and the G+C content can

all affect the accuracy of SSCP analysis (Nataraj et al.,

1999), so further experiments will be conducted to confirm

whether SSCP can analyze other genes as efficiently as it

did nad3/rps12 in cauliflower. Our results strongly suggest

that cDNA-SSCP is a powerful tool that can be used to

analyze the RNA editing status of target genes, especially

the rudimental RNA editing status.

Figure 6. Phylogenetic analysis of nad3/rps12 genes in CMS and male-fertile cauliflower and other species, which sequences of nad3/

rps12 now can be obtained from the databases of NCBI. The phylogenetic tree was constructed by neighbour-joining method, and the

bootstrap values were below the branches. The nad3/rps12 genes of CMS cauliflower were indicated as CMS cauliflower while that of

male-fertile were indicated as male-fertile cauliflower. The other species and their accession numbers are listed in Table 3.

Table 3. Species and corresponding accession numbers of nad3/rps12 obtained from the NCBI database.

Species

Accession

numbers Species

Accession

numbers Species

Accession

numbers

A. cepa

Z49771 M. grandiflora

X84106 P. ginseng

M74169

A. thaliana

Y08501 N. tabacum

BA000042 P. sativum

AY043195

B. napus

AP006444 N. sylvestris

X96741 P. sativum subsp. abyssinicum AY043192

H. annuus

X84008 O. berteriana

X52199 R. sativus

U43506

L. albus

AF035356 O. sativa

M57904 S. tuberosum

AF095279

L. mutabilis

AF035357 P. axillaris subsp. parodii M16770 S. bicolor

Y13329

Magnolia Ёб soulangeana Z49796 Petunia Ёб hybrida

U30458 V. radiata

AF071550

pg_0008

Botanical Studies, Vol. 48, 2007

Based on SSCP analysis combined with direct

sequencing, 12 different RNA editing patterns and

20 RNA editing sites (Table 2) have been found in

cauliflower nad3/rps12, a number greater than found in

Ogura and normal radish (Rankin et al., 1996), but smaller

than in Allium cepa, Triticum aestivum, Helianthus

annuus, Oenothera berteriana, Petunia hybrida, and

Magnolia soulangeana (Pesole et al., 1996; Wilson and

Hanson, 1996; Perrotta et al., 1996). In Ogura radish,

two different RNA editing patterns and three nad3/rps12

RNA editing sites have been described while no RNA

editing has been found in normal radish genes. In the

other six plants mentioned above, these genes contain

from 25 to 35 editing sites, implying that although nad3/

rps2 genes are conserved in evolution, their RNA editing

statuses may differ significantly. This may result from

differences in the nuclear background or from the need

to regulate gene expression. Interestingly, in both CMS

and male-fertile cauliflower, the nuclear background is

almost identical. However, the nad3/rps12 RNA editing

status is significantly different. In the 19 detected RNA

editing sites of CMS cauliflower NKC-A, partial editing

events are dominant (18/19), and each site can produce

nine different RNA editing patterns (Figure 3 and 4). In

contrast, in male-fertile cauliflower NKC-B more pre-

edited and fully edited sites were detected (15/20), and

only three different RNA editing patterns. Given that the

differences in nuclear background, growth conditions,

and developmental stages can be almost neglected, we

speculate that the differences in nad3/rps12 RNA editing

status between the two lines may have resulted from the

origin of these genes. Phylogenetic tree analysis data

demonstrated this (Figure 6), indicating that nad3/rps12

in CMS and fertile cauliflower belonged to different

branches and suggesting these genes may have derived

from different ancestors of the two lines. In addition,

the nad3/rps12 locus structure in both lines is different

in the 5ЁІ untranslated regions. We can speculate then

that given an identical nuclear background, the origin

and the structure of the nad3/rps12 locus may be the

main factors affecting RNA editing status in cauliflower.

Another unexpected result can also be obtained from the

analysis of the phylogenetic tree: almost all the species

can find their corresponding taxonomic positions in this

tree reconstructed based on the nad3/rps12. This implies

that the nad3/rps12 genes may become very valuable

candidates to evaluate the evolutionary relationships

between higher plants. In previous studies, they have been

used to analyze several angiosperms (Pesole et al., 1996).

Like RNA editing, cytoplasmic male sterility is an

important phenomenon in higher plant mitochondria

(Howad et al., 1999). Previous research has suggested that

novel chimeric genes, resulting from the mitochondrial

DNA rearrangements, were closely associated with the

CMS trait, which are believed to interfere with normal

pollen development (Schnable and Wise, 1998). Examples

include T-urf13 in T-maize (Dewey et al., 1986), orf355/

orf77 in S-maize (Zabala et al., 1997), orf79 in Bo-rice

(Akagi et al., 1994, 1995), pcf in petunia (Young and

Hanson, 1987), orf522 in PET1 sunflower (Sabar et al.,

2003), pvs in bean (He et al., 1995), orf138 in Ogura radish

(Bonhomme et al., 1992), orf224 and orf222 in pol and

nap Brassica napus, respectively, (LЁІHomme and Brown,

1993; LЁІHomme et al., 1997), orf107 in A3-sorghum (Tang

et al., 1996), and orf215 in sugar beet (Ivanov et al., 2004).

However, the molecular mechanism of CMS in cauliflower

is, to date, poorly understood. In our other study, a specific

chimeric open reading frame similar to orf138 in Ogura

radish was confirmed to be closely associated with the

CMS trait in cauliflower. It is of interest to note that all the

progenies of CMS cauliflower NKC-A, used as the female

parent, were 100% sterile, regardless of the status of the

male parent. To our knowledge, over the past two decades,

all attempts to create a restorer line of CMS cauliflower

NKC-A have been unsatisfactory. These results suggest

that the molecular mechanism of CMS in cauliflower

NKC-A may be more complex than those in other CMS

plants. We speculate that other factors, in addition to the

novel chimeric genes found in CMS cauliflower NKC-A,

may directly or indirectly affect this trait. Here, our study

confirmed that the RNA editing status of nad3/rps12 in

CMS cauliflower NKC-A and male-fertile cauliflower

NKC-B were significantly different, although no obvious

differences were found at the transcriptional level. More

RNA editing patterns and incomplete editing events were

detected in CMS cauliflower NKC-A. The diversity of

RNA editing patterns and insufficiency of certain RNA

editing sites in some genes have been identified associated

with the CMS trait in several plants such as atp6 and

orf107 in CMS sorghum (Tang et al., 1999; Howad et

al., 1999; Pring et al., 1998); atp6 and atp9 in CMS

wheat (Kurek et al., 1997), and orf77 in S-CMS maize

(Gallagher et al., 2002). This implies that the RNA editing

status of nad3/rps12 in CMS cauliflower NKC-A may

also be associated with the CMS trait. One possibility

is that the chimeric genes similar to the orf138 in Ogura

radish, the functional mitochondrial genes nad3/rps12,

and other unknown factors together affect the CMS trait

in cauliflower NKC-A. However, no direct experiments

have been done to confirm this hypothesis. To gain further

insight into the different RNA editing status in CMS and

male-fertile cauliflower and increase our knowledge of

RNA editing and the CMS trait, further investigations are

required. Our results offer significant clues toward their

elucidation.

Acknowledgments. We are grateful to Dr. Deling-Sun

and Dr. Qiancheng-Zhao, Tianjin Vegetable Research

Institute, Tianjin, China for advice and encouragement

during the course of this work and for kindly providing

the plant materials. We thank Dr. Suai-Zhang, and

Dr. Xuhong-Miao, College of Life Sciences, NanKai

University, Tianjin, China for discussion and critical

reading of the manuscript.

pg_0009

WANG et al. ЁX RNA editing analysis of

nad3/rps12

genes

LITERATURE CITED

Akagi, H., A. Nakamura, R. Sawada, M. Oka, and T. Fujjmura.

1995. Genetic diagnosis of cytoplasmic male sterile cybrid

plants of rice. Theor. Appl. Genet. 90: 948-951.

Akagi, H., M. S akam oto, C. S hinjyo, H. Shim ada, and T.

Fujjmura. 1994. A unique sequence located downstream

from the rice mitochondrial atp6 may cause male sterility.

Curr. Genet. 25: 52-58.

Barth, C., U. Greferath, M. Kotsifas, and P.R. Fisher. 1999.

Polycistronic transcription and editing of the mitochondrial

sm all subunit (SSU) ribos om al RNA in Di ctyoste lium

discoideum. Curr. Genet. 36: 55-61.

Benne, R. 1996. RNA editing: How a message is changed. Curr.

Opin. Genet. Dev. 6: 221-231.

Bock, R. 2000. Sense from nonsense: how the genetic

inform ation of chloroplas ts is altere d by RNA e diting.

Biochimie 82: 549-557.

Bonhomme, S., F. Budar, D. Lancelin, I. Small, M.C. Defrance,

and G. Pelletier. 1992. Sequence and transcript analysis

of the Nco2.5 Ogura-s pecific fragment correlated with

cytoplasmic male sterility in Brasscia cybrids. Mol. Gen.

Genet. 235: 340-348.

Chapdelaine, Y. and L. Bonen. 1991. The wheat mitochondrial

gene for subunit I of the NADH dehydrogenase complex:

a trans-splicing model for this gene-in-pieces. Cell 65:

465-472.

Corneille, S., K. Lutz, and P. Maliga. 2000. Conservation of

RNA editing between rice and maize plastids : are most

editing events dispensable.. Mol. Gen. Genet. 264:

419-424.

Dewey, R.E., C.S.III. Levings, and D.H. Timothy. 1986. Novel

recombinations in the maize mitochondrial genome produce

a unique trans criptional unit in the Texas m ale-sterile

cytoplasm. Cell 44: 439-449.

Fels enstein, J. 1985. Confidence limits on phylogenies: An

approach using the bootstrap. Evolution 39: 783-791.

Fuchs, M., R.M. Maier, and P. Zeltz. 2001. RNA editing in

higher plant plastids: oligoribonucleotide SSCP analysis

allows the proof of base conversion directly at the RNA

level. Curr. Genet. 39: 384-387.

Gallagher, L.J., S.K. Betz, and C.D. Chase. 2002. Mitochondrial

RNA editing truncates a chim eric ope n rea di ng frame

associated with S male-sterility in maize. Curr. Genet. 42:

179-184.

Giege, P. and A. Brennicke. 1999. RNA editing in Arabidopsis

mitochondria effects 441 C to U changes in ORFs. Proc.

Natl. Acad. Sci. USA 96: 15324-15329.

Grosskopf, D. and R.M. Mulligan. 1996. Developmental- and

tiss ue-spec ificity of RNA editing in mit oc hondrial of

suspension-cultured maize cells and seedlings. Curr. Genet.

29: 556-563.

He, S ., A. Lyznik, and S . Mackenzie. 1995. Pollen fertility

res toration by nuclear gene Fr in CMS bean: nuclear-

directed alteration of a mitochondrial population. Genetics

139: 955-962.

Hoch, B., R.M. Maier, K. Appel, G.L. Igloi, and H. Kossel.

1991. Editing of a chloroplas t mRNA by creation of an

initiation codon. Nature 353: 178-180.

Howad, W., H.V. Tang, D.R. Pring, and F. Kem pken. 1999.

Nuclear genes from TЁбCMS maintainer lines are unable to

maintain atp6 editing in any anther cell-type in the Sorghum

bicolor A3 cytoplasm. Curr Genet. 36: 62-68.

Itani, K. and H. Handa. 1998. Rapeseed mitochondrial ccb206, a

gene involved in cytochrome c biogenesis, is co-transcribed

with the nad3 and rps12 genes: organization, transcription,

and RNA editing of the nad3/rps12/ccb206 locus. Curr.

Genet. 34: 318-325.

Iva nov, M.K., A.S . Reve nko, and G.M. Dym shi ts . 2004.

Cytoplasmic male sterility-associated structural variation

of the mitochondrial genome regions containing rps3 and

orf215 in sugar beet Beta vulgaris L. Mol. Biol. (Mosk).

38: 413-419.

Iwabuchi, M., J. Kyozuka, and K. Shimamoto. 1993. Processing

followe d by com pl ete editing of an altered atp6 RNA

restores fertility of cytoplasmic male sterile rice. EMBO J.

12: 1437-1446.

Ka dowaki , K.I., K. Oz awa, S . Kaz am a, N. Kubo, an d T.

Akihama. 1995. Creation of an initiation codon by RNA

editing in the coxl trans cript from tomato mitochondria.

Curr. Genet. 28: 415-422.

Kempken, F., J .A. Mullen, D.R. Pring, and H.V. Tang. 1991.

RNA editing of sorghum mitochondrial atp6 transcripts

changes 15 amino acids and generates a carboxy-terminus

identical to yeast. Curr. Genet. 20: 417-422.

Krishnasamy, S., R.A. Grant, and C.A. Makaroff. 1994. Subunit

6 of F

-ATP synthase complex from cytoplas mic male-

s terile radish: RNA editing and NH2-terminal protein

sequencing. Plant Mol. Biol. 24: 129-141.

Kudla , J., G.L. Igloi, M. Metz laff, R. Hagem ann, and H.

Kossel. 1992. RNA editing in tobacco chloroplasts leads

to the formation of a translatable psbL mRNA by a C to

U substitution within the initiation codon. EMBO J. 11:

1099-1103.

Kudla, J. and R. Bock. 1999. RNA editing in an untranslated

region of the Ginkgo chloroplast genome. Gene 234: 81-86.

Kurek, I., D. Ezra, D. Begu, N. Erel, S. Litvak, and A. Breiman.

1997. Studies on the effects of nuclear background and

tissue specificity on RNA editing of the mitochondrial ATP

synthase subunits a, 6 and 9 in fertile and cytoplasmic male-

sterile (CMS) wheat. Theor. Appl. Genet. 95: 1305-1311.

LЁІHomme, Y. and G.G. Brown. 1993. Organizational differences

between cytoplasmic male sterile and male fertile Brasscia

mitochondrial genomes are confined to a single transposed

locus. Nucleic Acids Res. 21: 1903-1909.

LЁІHomme, Y., R.J. Stahl, X-Q. Li, A. Hameed and G.G. Brown.

1997. Brassica nap cytoplasmic male sterility is associated

with expression of a mtDNA region containing a chimeric

gene similar to the pol CMS-associated orf224 gene. Curr.

Genet. 31: 323-335.

pg_0010

Botanical Studies, Vol. 48, 2007

Mahendran, R., M.S. Spottswood, A. Ghate, M.I. Ling, K. Jeng,

and D.L. Miller. 1994. Editing of the mitochondrial small

subunit rRNA in Physarum polycephalum. EMBO J. 13:

232-240.

Maier, R.H., P. Zeltz, H. Kossel, G. Bonnard, J.M. Gualberto,

and J .M. Griene nberge r. 1996. RNA edi ting i n plan t

mi tochondria l and chloropl as ts. P lant Mol . B iol. 32:

343-365.

Murray, M.G. and W.F. Thomps on. 1980. Rapid isolation of

high weight plant DNA. Nucleic Acids Res. 8: 4231-423.

Nataraj, A.J., I. Olivos-Glander, N. Kusukawa and

W.E.J r. Highs mith. 1999. S ingle-s tra nd c onforma tion

polymorphism and heteroduplex analysis for gel-based

mutation detection. Electrophoresis 20: 1177-1185.

Orita , M., H. Iwa hana, H. Kanaz awa, K. Haya shi , a nd T.

Sekiya. 1989. Detection of polymorphism of human DNA

by gel e lect rophore si s as s ingle-s trand c onform ati on

polymorphisms. Proc. Natl. Acad. Sci. USA 86: 2766-2770.

Perrotta, Q., T.M. Regina, L.R. Ceci, and C. Quagliariello. 1996.

Conservation of the organization of the mitochondrial nad3

and rps12 genes in evolutionarily distant angiosperms. Mol.

Gen. Genet. 251: 326-337.

Pesole, G., L.R. Ceci, C. Gissi, C. Saccone, and C. Quagliariello.

1996. Evolution of nad3-rps12 gene cluster in angiosperm

m it oc h ond ri a : co m pa ri s on of e di te d a nd un ed it e d

sequences. J. Mol. Evol. 43: 447-452.

Pring, D.R., W. Chen, H.V. Tang, W. Howad, and F. Kempken.

1998. Inte ract ion of m itoc hondrial RNA edit ing a nd

nucleolytic processing in the restoration of male fertility in

sorghum. Curr. Genet. 33: 429-436.

Rankin, C.T., M.T. Cutright, and C.A. Makaroff. 1996.

Characterization of the radish mitochondrial nad3/rps12

locus: analysis of recombination repeats and RNA editing.

Curr. Genet. 29: 564-571.

Sabar, M., D. Gagliardi, J. Balk, and C.J. Leaver. 2003. ORFB

is a subunit of F1F(O)-ATP synthase: insight into the basis

of cytoplasmic male sterility in sunflower. EMBO Rep. 4:

381-386.

Saitou, N. and M. Nei. 1987. The neighbor-joining method: a

new method for reconstructing phylogenetic trees. Mol.

Biol. Evol. 4: 406-425.

S ato, Y. and T. Nis hio. 2002. E ffi cie nt dete ction of DNA

polymorphism in cabbage and rice cultivars by PCR-RF-

SSCP (PRS). Plant Cell Rep. 21: 276-281.

Schuster, W., R. Ternes, V. Knoop, R. Hiesel, B. Wissinger, and

A. Brennicke. 1991. Distribution of RNA editing sites in

Oenothera mitochondrial mRNAs and rRNAs. Curr. Genet.

20: 397-404.

Schuster, W. and A. Brennicke. 1994. The plant mitochondrial

genome: physical s tructure, inform ation content, RNA

editing, and gene migration to the nucleus. Ann. Rev. Plant

Physiol. Plant Mol. Biol. 45: 61-78.

S chnable , P.S. and P. Wis e. 1998. T he mol ecular ba sis of

cytoplasmic male sterility and fertility restoration. Trends

Plant Sci. 3: 175-180.

Slabaugh, M.B., G.M. Hues tis, J. Leonard, J .L . Holloway,

C. Rosa to, V. Hongtrakul, N. Martini, R. Toepfer, M.

Voetz, J. Schell, and S.J. Knapp. 1997. Sequence-based

genetic markers for genes and gene families: single-strand

conformational polymorphisms for the fatty acid synthesis

genes of Cuphea. Theor. Appl. Genet. 94: 400-408.

Smith, H.C., J .M. Gott, and M.R. Hanson. 1997. A guide to

RNA editing. RNA. 3: 1105-1123.

Steinhauser, S., S. Beckert, I. Capesius, O. Malek and V. Knoop.

1999. Plant mitochondrial RNA editing. J. Mol. Evol. 48:

303-312.

Tang, H.V., D.R. Pring, L.C. Shaw, R.A. Salazar, F.R. Muza,

B.Ya n, a nd K.F. S chertz. 1996. Trans cript proces sing

internal to a mitochondrial open reading frame is correlated

with fertility restoration in male-sterile sorghum. Plant J.

10: 123-133.

Tang, H.V., W. Chen, and D.R. P ring. 1999. Mitoc hondrial

orf107 trans cription, editing, and nuc leolytic cleavage

conferred by the gene Rf3 are expressed in sorghum pollen.

Sex Plant Reprod. 12: 53-59.

Thompson, J.D., D.G. Higgins, and T.J. Gibson. 1994.

CLUS TAL W: improving the sensitivity of progressive

multiple sequence alignment through sequence weighting,

position specific gap penalties and weight matrix choice.

Nucleic Acids Res. 22: 4673-4680.

Wakasugi, T., T. Hirose, M. Horihata, T. Tsudzuki, H. Kossel,

and M. Sugiura. 1996. Creation of a novel protein-coding

region at the RNA level in black pine chloroplasts: the

pattern of RNA editing in the gymnosperm chloroplast is

different from that in angiosperms. Proc. Natl. Acad. Sci.

USA 93: 8766-8770.

Ward, G.C. and C.S.III. Levings. 1991. The protein-encoding

gene T-urf13 is not edited in m aize mitochondria. P lant

Mol. Biol. 17: 1083-1088.

Wilson, R.K. and M.R. Hanson. 1996. Preferential RNA editing

at specific sites within transcripts of two plant mitochondrial

genes does not depend on transcriptional context or nuclear

genotype. Curr. Genet. 30: 502-508.

Wintz, H. and M.R. Hanson. 1991. A term ination codon is

created by RNA editing in the petunia atp9 transcript. Curr.

Genet. 19: 61-64.

Yoshinaga, K., H. Iinuma, T. Masuzawa, and K. Uedal. 1996.

Extensive RNA editing of U to C in addition to C to U

substitution in the rbcL transcripts of hornwort chloroplasts

and the origin of RNA editing in green plants. Nucleic

Acids Res. 24: 1008-1014.

Young, E.G. and M.R. Hans on. 1987. A fused mitochondrial

g ene a s s oc ia t ed wit h c yt op la s m ic m al e s te ri li ty is

developmentally regulated. Cell 50: 41-49.

Zabala, G., S. Gabay-Laughnan, and J.R. Laughnan. 1997. The

nuclear gene Rf3 affects the expression of the mitochondrial

chimeric sequence R implicated in S-type male sterility in

maize. Genetics 147: 847-850.

Zanlungo, S ., V. Quinones, A. Moenne, L. Holuigue, and X.

Jordana. 1995. Splicing and editing of rps10 transcripts in

potato mitochondria. Curr. Genet. 22: 565-571.

pg_0011

WANG et al. ЁX RNA editing analysis of

nad3/rps12

genes

pg_0012