pg_0001

Botanical Studies (2007) 48: 25-34.

Corresponding author: E-mail: rlin@faculty.pccu.edu.tw;

Tel: +886-2-28610511 ext. 31132.

INTRODUCTION

APX (EC 1.11.1.11) is a hydrogen peroxide-scavenging

enzyme with a presumed function of protecting cells

from hydrogen peroxide accumulation, particularly under

stressful conditions. It catalyzes the reduction in hydrogen

peroxide, using ascorbate as an electron donor, to yield

water and oxidized ascorbate. The lack of suitable electron

acceptors leads to the saturation of redox chains, the

accumulation of NADPH, and a decline in ATP generation.

The ascorbate-glutathione cycle has been shown to be of

great importance in multiple stress reactions (Blockina et

al., 2003). In flooded soil, oxygen limitation is one of the

primary threats to plants. Excess production of reactive

oxygen species (ROS)—superoxide radicals, hydrogen

peroxide, singlet oxygen, and hydroxyl radicals—causes

oxidative damage to cellular components, and their

involvement in a number of biotic and abiotic stresses is

well documented (Shigeoka et al., 2002). APX has been

found in higher plants, algae, and some cyanobacteria, but

not in animals (Shigeoka et al., 2002). In higher plants,

APX isozymes are distributed in at least four distinct

cellular compartments: stromal APX (sAPX) and thylakoid

membrane-bound APX (tAPX) in chloroplasts, microbody

(including glyoxysome and peroxisome) membrane-

bound APX (mAPX), mitochondrial membrane-bound

APX (mitAPX), and cytosolic APX (cAPX) (Kawakami

et al., 2002). For example, in Arabidopsis, the APX gene

family includes two cytosolic isoforms, APX1 and APX2,

microsomal enzyme APX3, cAPX, sAPX, and tAPX

(Jespersen et al., 1997). Heat stress induces oxidative

stress and triggers the expression of APX1 and APX2

genes at the RNA level in Arabidopsis. Excessive light

stress also induces APX1 expression (Karpinski et al.,

1997; Panchuk et al., 2002).

Antioxidant enzymes and their corresponding genes

have been studied in many species. We have already

demonstrated that flooding stress raised ROS levels in

plants and induced various kinds of antioxidative enzymes

to overcome oxidative stress (Lin et al., 2004). APX was

at its most active in eggplant roots under flooding stress

and played an important role in detoxifying the H

that flooding had generated in eggplant root. Saturation

Cloning and expression analysis of ascorbate

peroxidase gene from eggplant under flooding stress

Kuan-Hung LIN

*, Hsiao-Feng LO

, Chun-Hung LIN

, and Ming-Tsir CHAN

Department of Horticulture, Chinese Culture University, Taipei, Taiwan

Graduate Institute of Biotechnology, Chinese Culture University, Taipei, Taiwan

Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan

(Received February 3, 2006; Accepted June 23, 2006)

ABSTRACT.

Previously, we found that flooding leads to an increase in APX enzymatic activity in the roots

of eggplants. The objectives of this work were to clone the ascorbate peroxidase (APX) gene, and measure

the regulation of APX gene expression in different tissues of eggplant under flooding stress conditions.

Different tissues from eggplants displayed wide variations in their expression profiles using Real-Time

PCR. The highest level of APX transcripts were detected in roots of EG117 at 72 h of flooding treatment.

The differential expressions of each tissue and genotype were directly associated with flooding stress

responses. After screening and comparing APX gene sequences at the NCBI database, the degenerate primer

sets designed from tomato and potato were used to amplify the APX cDNA of eggplant with the reverse-

transcription PCR method. The completion of a full-length of APX cDNA was performed using 5’ and 3’

rapid amplification of cDNA ends (RACE) technique. The open reading frame of cDNA clone was 753 base

pair long encoding a cytosolic APX (cAPX). The sequence of eggplant APX gene had 96%, 95%, 93% and

91% homology to that from the potato, tomato, pepper and tobacco APX gene, respectively. A phylogenetic

analysis of the deduced amino acid sequence of APX by Neighbor-Joining method indicated that the plant

cAPXs diverge into two major clusters, and eggplant cDNA is more closely related to potato than to tomato.

Southern blot analysis revealed that the eggplant gene encoding APX had two copies. These results indicate

that the cAPX of eggplant may be involved in hydrogen peroxide-detoxification and thus helps overcome the

stress induced by flooding.

Keywords:

Ascorbate peroxidase; Eggplant; Flooding; Phylogenesis; Real-Time PCR.

MOLECULAR BIOLOGY

pg_0002

Botanical Studies, Vol. 48, 2007

of soil fills air pockets with water, creating hypoxic

conditions followed by anoxia. During flooding stress,

many physiological changes occur that result in increased

flooding tolerance. One of these may be increased

expression of APX genes to protect against oxidative

stress. cDNAs which encode APX of pea (Mittler and

Zilinskas, 1992), tomato (Gadea et al., 1999; Zou et

al., 2006), sweet potato (Tseng et al., 2002; Park et al.,

2004; Lin et al., 2006), potato (Kawakami et al., 2002),

Arabidopsis (Kubo et al., 1992; Santos et al., 1996),

pumpkin (Yamaguchi et al., 1996), spinach (Webb and

Allen, 1995; Ishikawa et al., 1996), maize (Bresegem et

al., 1995), strawberry (Kim and Chung, 1998), tobacco

(Ovar and Ellis, 1997), and barley (Shi et al., 2001) have

been isolated. However, eggplant APX cDNA has not

been cloned, and it is not known which form of APX

efficiently detoxifies H

in eggplant roots under flooding

stress. Nothing is known about the response of APX gene

expression and regulation under flooding stress. In this

study, we investigate how APX gene expresses in different

tissues of eggplants in response to flooding treatment. We

also clone a full-length APX cDNA, and analyze evolution

of the APX gene among plant species.

MATERIALS AND METHODS

Plant materials, cultivation and flooding

treatment

‘Pingtong Long Eggplant’ (EG117) and eggplant

‘EG203’ were sown on April 2004 in the greenhouse

of the Chinese Culture University. EG117 is more

flood tolerant than EG203, and is used as rootstock for

tomatoes in Taiwan (Lin et al., 2004). The seedlings were

transplanted into 5-inch plastic pots containing a medium

consisting of peat moss, loamy soil, and sand in a ratio

of 2:1:1 (v/v/v) on May 2004. Plants were watered every

other day, and an optimal amount of compound fertilizer

solution (N-P

-K

O, 20-20-20) was applied once a

week. The two mentioned varieties (EG117 and EG203)

and ten flooding treatments (0 min, 15 min, 30 min, 1 h,

3 h, 6 h, 12 h, 24 h, 48 h and 72 h) were carried out on

July, 2004, when the plants were 15 cm high. All pots for

three replications of each flooding time for the treatment

group were randomly placed in a 28 cm × 14 cm × 14

cm plastic bucket containing a tap water level 5cm above

the medium surface. At different points in time following

flooding, plants were taken out of the medium, and their

roots were washed by rinsing with tap water. Roots, leaves

and flowers from each plant were clipped and carried

in an icebox to the laboratory in less than five min, and

immediately frozen in liquid nitrogen. They were then

stored in a -70°C freezer for subsequent analysis.

DNA sequence database analysis

Database searches were performed at the National

Center of Biotechnology Information (NCBI) server

(http://www.ncbi.nlm.nih.gov) with Entrez, BLAST. At

the time, no eggplant APX had been characterized and

therefore a Solanum cDNA was used as a query. APX

genes were identified by sequence similarities to known

APX genes of tomato (Gene Bank accession number

Y16773) and potato (Gene Bank accession number

AB041343). Only full length APX sequences were

included in the analysis. After homology searches using

BLAST, sequence alignments were constructed with the

Clustal-X program (Thompson et al., 1997). Specific

primer sets for APX gene were designed using Vector

NTI Suite 8.0 software within the manufacturer’s default

criteria (InforMax, Frederick, MD, USA). The designed

sequences (20 mers) of APX 1, 2 and 3 were as follows:

APX1, 5’ ATGGGTAAGTGCTATCCCAC 3’ (sense),

APX2, 5’ ATGGGTAAGTCCTATCCCAC 3’ (antisense),

APX3, 5’ TTAAGCTTCAGCAAATCCCA 3’ (antisense).

These sense and antisense primers were custom

synthesized by Bioengineer Biotech (Taipei, Taiwan) and

designed to amplify a 753 bp region of the APX gene

segment.

Amplification of eggplant cDNA using primer

sets (APX1, APX2) and (APX1, APX3)

Total RNA was isolated from different flooding times

from different parts of eggplants with a NucleoSpin

RNA Plant Kit (Macherey Nagel, Duren, Germany) and

quantified with GeneQuant (Amersham Biosciences,

Buckinghamshire, UK) at 260 nm. First strand cDNA was

synthesized from 1 μg of total RNA using AMV-reverse

transcriptase with random hexamers according to the

manufacture’s instructions (Boehringer Mannheim). Paired

primers (APX1, APX2) and (APX1, APX3) were used

for amplification. PCR was carried out in an Eppendorf

Mastercycler Gradient Thermal Cycler (Hamberg,

Germany) with the following thermal program: initial

denaturation at 95°C for 3 min, followed by 35 cycles of

95°C for 1 min, 47°C for 1 min, and 72°C for 2 min, with

a final extension at 72°C for 7 min. PCR products were

electrophoretically separated on a 1% agarose gel, and the

predicted size of 753 bp was verified with a 100 bp DNA

ladder of DNA marker (see Figure 1). The products were

then sequenced using the same primer in combination

with the Big Dye Terminator Cycle Sequencing Kit and

ABI Prism 310 Genetic Analyzer (Applied Biosystem,

Foster City, CA, USA). DNA sequences were compared

with sequences deposited in the aforementioned BLAST

program.

DNA gel blot analysis

Leaves of EG117 and EG203 were ground to a fine

powder with a mortar and pestle in liquid nitrogen.

Genomic DNA was prepared essentially as previously

described (Doyle and Doyle, 1990). Fifteen micrograms

of DNA was digested with 30 units of ECoRI, BamHI

and HindIII (Boehringer Mannheim, Germany), and then

separated on 1% agarose gel. The separated DNA bands

were transferred to a nylon membrane (Hybond-N

pg_0003

LIN et al. — Cloning APX gene from flooded eggplant

Amersham) by downward capillary alkaline transfer.

The DNA was crosslinked to the membrane by UV

crosslinker (SpectroLine, Westburg, NY, USA). The

753 bp product was amplified using the aforementioned

‘Mastercycler gradient’ in an annealing temperature of

47°C. APX probe (753 bp) was labeled with the DIG

Probe Synthesis Kit (Roche, Mannheim, Germany) as

recommended by the manufacturer. The membrane was

incubated in 1% blocking agent for 30 min and in an

antibody solution-diluted anti-DID-AP conjugate for 30

min. After washing, the membrane was equilibrated and

detected following the protocol of the CDP-Star Detection

Kit (Roche). Autoradiography was carried out with Kodak

Chemiluminescent Detection Film for 15 min, and the

result is presented in Figure 2.

Rapid amplification of cDNA ends (RACE)

The amplification of the remaining part of the

corresponding APX gene was obtained by RACE.

For the isolation of the 5’-end of APX cDNA, the 5’-

RACE technique was performed according to the

protocol provided with the FirstChoice RLM-RACE

Kit purchased from Ambion (Austin, TX, USA). For

the completion of the 3’-end of the obtained cDNA

fragments, the 3’-RACE method was also performed

as described in the manufacturer’s instructions. The

following oligonucleotide sequences were used as inner

and outer primers of nested PCR for 5’ and 3’ RLM-

RACE: CCAGGGTGAAAGGGAACA (5’ RACE gene

specific inner primer), TGTCAAAGATAAGGGGA

TTGGTGGT (5’ RACE gene specific outer primer),

AAGCTGAGCAGCACATGG (3’ RACE gene specific

inner primer), and AGAGCACTCATTGCTGAAGAAAG

AA (3’ RACE gene specific outer primer). The PCR steps

were: 3 min at 95°C, then 35 cycles of 95°C for 30 s, 60°

C for 30 s and 72°C for 40 s, followed by 72°C for 7 min.

The primer sets for 5’ cDNA and 3’ cDNA were designed

to produce 950 bp and 500 bp fragments, respectively (see

Figure 5).

Cloning of APX gene

The amplified PCR products were separated on

1% agarose gel, purified with the High Pure Product

Purification Kit (Roche) and cloned into yT&A vector

(Yeastern Biotech. Coop., Taipei, Taiwan, see Figure 6),

following the protocol supplied. Transformations were

carried out using DH-5α competent cells (Invitrogen,

San Diego, CA, USA) and plated on LB plates with

ampicillin (50 μg/ml), 5-bromo-4-chloro-3-indolyl-B-

D-gaalctosidase (0.4%) and isopropyl-B-D-thiogalacto-

pyrano-side (0.1 mM). White colonies were selected for

plasmid isolation, and digested BamHI and HindIII were

used to release the insert. Sequencing was performed by

ABI Prism 310 Genetic Analyzer as described earlier.

DNA sequences were compared with sequences deposited

in the GeneBank database using the BLAST program.

Figure 1. Paired primer sets APX1, APX2 and APX1, APX3

de s igne d fro m t om at o AP X g ene an d pot at o AP X ge ne ,

res pec tive ly, were use d to am pli fy a 753-bp in l engt h of

AP X cDNA in different tissues of eggplants. Lanes from 1

to 6 represent EG117 root, EG203 root, EG117 leaf, EG203

leaf, EG117 flower and EG203 flower, respectively. Reverse

transcription PCR products from lanes 1, 3 and 5 were generated

from APX1 and APX2 primers; furthermore, the bands of lanes

2, 4 and 6 were generated from APX1 and APX3 primers. M=

100 bp ladder DNA marker (Gibco-BRL).

Figure 2. Southern blot hybridization of the PCR product for

analysis of the APX gene. Eggplant genomic DNA (15 μg/lane)

wa s diges ted with restriction enzymes and electrophores ed

through 1% agarose gel. V1=EG117, V2= EG203. M=Molecular

Weight Marker II DIG-labeled (Roche).

pg_0004

Botanical Studies, Vol. 48, 2007

Real-Time PCR (RT-qPCR) and quantification of

RNA levels

The expression levels of APX gene at various

flooding times were determined by RT-qPCR using

a Roter-Gene G3000 Detection System (Corbett

Research, Sydney, Australia). Ubiquitin gene was

used as a reference gene. After screening the database

for Solanum sequences, specific primer sets for

ubiquitin and APX gene were designed using the

mentioned Vector NTI Suite 8.0 software. The primers

for ubiquitin (Hoffman et al., 1991) and APX were:

qUBI1, 5’ ATGCAGATCTTCGTGAAAAC 3’;

qUBI2, 5’ AGCACCGCACTCAGCATT 3’; qAPX1,

5’ AAGCTGAGCAAGCACATGG 3’; qAPX2, 5’

CCAGGGTGAAAGGGAACA 3’. Amplification of PCR

products was monitored via intercalation of SYBR-Green

(Molecular Probes; 1:1,000 dilution of 10,000x stock

solution). The following program was applied: initial

polymerase activation: 95°C, 5 min; then 40 cycles at 95°

C, 10 s; 58°C, 10 s; 72°C, 20 s. The Roter-Gene software,

Version 6.0 was used for threshold selection and standard

curve interpolation to derive RNA concentrations relative

to the RNA standard. These relative RNA quantities of

RNA samples are presented as ‘Expression’ values in

Figures 3 and 4 and allowed the comparison of relative

RNA amounts among treatments.

Phylogenetic relationship analysis

The deduced amino acid sequence of the eggplant

APX was aligned and compared with other plant APX

using the Cluster-W software (Thompson et al., 1994)

with the default settings. Phylogenetic trees were inferred

using MEGA, Version 3.0 (Kumar et al., 2001). The

neighbor joining, minimum evolution and maximum

parsimony methods of tree generation were used to assess

evolutionary relationships (Rzhetsky and Nei, 1992;

Saitou and Nei, 1987). The significance of clustering was

evaluated by bootstrap with 1,000 replications.

RESULTS

Primer design for APX gene in eggplant

Degenerate paired primers (APX1, APX2 and APX1,

APX3) were designed by comparing the APX cDNA

conserved sequences from Solanum lycopersicum

and Solanum tuberosum, respectively. The paired

oligonucleotides were used to amplify a cDNA fragment

(753 bp) from a single-strand cDNA made from RNA

extracted from different tissues (root, leaf and flower)

of each genotype (EG117 and EG203). The reverse

transcription-PCR products were shown in Figure 1. The

bands (lanes 1, 3 and 5) generated from APX1 and APX3

primers appeared higher in intensity and brightness than

the bands (lanes 2, 4 and 6) generated from APX1 and

APX2 primers. This indicates that the APX1 and APX3

primer set had a higher specificity to eggplant DNA than

the APX1 and APX2 primer set, and it was therefore used

Figure 3. Real-Time PCR of APX transcripts response from

root, leaf and flower of EG117 exposed to 0- to 72-h flooding.

Relative amounts were calculated and normalized with respect

to ubiquitin RNA.

Figure 4. Real-Time PCR of APX transcripts response from

root, leaf and flower of EG203 exposed to 0- to 72-h flooding.

Relative amounts were calculated and normalized with respect

to ubiquitin RNA.

Figure 5. yT&A vector with multiple cloning sites . Am p=

ampicilline gene.

pg_0005

LIN et al. — Cloning APX gene from flooded eggplant

for Southern hybridization, RT-qPCR and RACE.

Southern blot analysis

To prove the existence of APX DNA in the EG117 and

EG203, genomic Southern hybridization was carried out

using the 753 bp fragment as a probe. Figure 2 presents

those two hybridization bands for DNA digested with

ECoRI, BamHI, and HindIII enzymes. This result indicates

that two copies of APX gene exist in the eggplant genome.

In addition, no recognition sites of ECoRI, BamHI and

HindIII were found within the cDNA of the APX (see

Figure 7).

Changes in the RNA level of APX gene in

different tissues under flooding treatments

Quantification of the RNA levels of APX gene was

performed using RT-qPCR of reverse transcripts of RNA

from root, leaf, and flower of EG117 and EG203 that had

been subjected to flooding from 0 h to 72 h (Figures 3 and

4). The data were normalized with respect to the RNA

level of ubiquitin, a housekeeping gene that is constantly

expressed in plants. The trend and level of the increase

in APX RNA expression over time were different in EG

Figure 6. Nested RT-PCR for 5’ RLM-RACE product (lane 1)

and nested RT-PCR for 3’ RLM-RACE product (lane 2). M=

100 bp ladder DNA marker (Gibco-BRL).

Figure 7. Nucleotide sequence of the full-length APX clone from eggplant (892 bp). APX cDNA contains an open reading frame

(753 bp), 5’ untranslated region (18 bp), 3’ untranslated region (21 bp), and the locations of each primer (APX1, APX3 and M13), T7

promoter and restriction enzymes (BamHI and HindIII). *ATG, start codon. →TAA, stop codon. GGATCC, BamHI site. AAGCTT,

HindIII site.

pg_0006

Botanical Studies, Vol. 48, 2007

117 (Figure 3). The RNA level of APX gene in the root of

EG117 was accumulated at different rates from 0 h (3.34)

to 72 h (12.6) of flooding. APX RNA expression in EG117

leaf increased from 0 h (3.57) to 1 h (6.52) of flooding,

fell to 3.51 at 6 h of flooding, and then peaked (11.5) after

72 h of flooding treatment. The transcript of the APX gene

for EG117 flower initially increases up to 3 h of flooding

(8.81) and then begins to decrease to 6.44 at 12 h of

flooding. At 24 h of flooding, the level peaked at 9.77 and

began to drop thereafter. Waterlog stress over time caused

a change in APX transcript, which was found to be more

abundant in the root and leaf compared to flowers at 72 h

of flooding.

Figure 4 presents the effect of flooding time on the

expression of APX gene in EG 203. The level of APX

gene in EG203 root showed irregular changes. The

maximal increase (7.83) was found at 48 h of flooding

treatment and was threefold the level at 0 h flooding time

(2.09). APX gene transcript of EG203 leaf was affected

during the time course of flooding, and the highest (8.48)

and lowest (1.85) levels were observed at 12 h and 0 h of

waterlog treatment, respectively. A slight increase in APX

transcript was noted in EG203 flower as the flooding time

was extended, with the exception of a decreased level

from 7.25 (48 h) to 3.88 (72 h). The APX gene was more

expressed in the root (5.18) than in the leaf (4.00) and

flower (3.88) at 72 h of flooding.

Cloning of APX cDNA from RACE

The inner and outer fragments (nested primers) were

used to amplify a full-length of APX cDNA, using the 5’

and 3’-RACE method. Figure 5 shows the 5’ and 3’

reverse transcription PCR products of 950 bp (lane 1) and

500 bp (lane 2), respectively. These PCR products were

purified, cloned and sequenced, and the sequences were

compared with sequences deposited in the GeneBank

database of NCBI BLASTN. The full length clone

contains an eggplant APX cDNA that is 892 bp in length

and has an open reading frame of 753 bp in length (Figure

7). The cDNA is initiated by an ATG, terminated by TAA,

and contains an 118-bp 5’ untranslated region and 21-bp

3’ untranslated region. The GC content of the coding

region was 48%. Figure 7 also shows the locations of

BamHI and HindII, and sequences of M13 primers and T7

promoter.

Evolutionary analysis of plant APX gene

The sequence of the APX cDNA (753 bp) showed a

significant level of similarity with Solanum tuberosum

(AB041343), Solanum lycopersicon (Y16773), Nicotiana

tabacum (U15933), and Capsicum annum (AY078080).

The deduced APX amino acid sequences from five plant

species were aligned and compared. Figure 8 represents

a phylogenetic tree from the conserved region using the

Neighbor-Joining method. Phylogenetic analysis revealed

that eggplant APX is more closely related to potato cAPX

than to tomato cAPX. Eggplant and potato showed 64%

homology of identity to cAPX. Specific groups of cAPX

evolved and expanded independently into two groups.

Moreover, these two trees inferred from the cAPX protein

sequences did not show a violation of the plant taxonomy.

Eggplant, potato, and tomato are members of Solanum,

and were clustered together. However, pepper was

clustered with tobacco with a bootstrap 99, which formed

a clade with Solanum species.

DISCUSSION

Increased RNA levels were sustained up to 72 h after 6

h of flooding treatment in leaf and root of EG117 (Figure

3). Therefore, APX transcripts were up-regulated in

response to flooding. Higher RNA levels were induced by

the elevated flooding stress. This result is consistent with

our previous report that APX activity increased markedly

in roots of EG117 subjected to flooding stress (Lin et al.,

2004). In addition to flooding, several other environmental

factors, such as chilling, light, drought, ozone, paraquat

treatment, and air pollutants, have also been known to

up-regulate APX expression in higher plants (Mittler and

Zilinskas, 1994; Ovar and Ellis, 1997; Morimura et al.,

1999; Yoshimura et al., 2000; Kornyeyev et al., 2003;

Murgia et al., 2004).

The APX gene of eggplant differs greatly in its

expression pattern in different plant tissues. Although the

APX transcripts were detected in all tissues, this gene

was most strongly active in root. In contrast, APX gene

Figure 8. Phylogenetic tree inferred from the APX protein sequences by the Neighbor-Joining method. Numbers indicate bootstrap

support for individual nodes. The scale on the bottom shows the number of substitutions per amino acid site.

pg_0007

LIN et al. — Cloning APX gene from flooded eggplant

showed a rather low activation in flowers (Figures 3 and

4). This clearly suggests the functional differentiation

of plant tissues. Furthermore, the genotypic response to

APX transcript under flooding was inconsistent and did

not follow any pattern. Different plant genotypes were

prepared for oxidative injury by up-regulating their APX

transcripts during waterlogged conditions. In general, the

RNA levels of EG117 tissues at 0 h, 1 h, 3 h, 24 h and 72

h of flooding were higher than those of EG203 tissues.

Particularly, when flower tissues across flooding time were

compared, EG117 (Figure 3) exhibited a higher APX RNA

level than EG203 (Figure 4). These results indicate that

APX transcripts responded differently under waterlogged

conditions for different plant genotypes.

No strong visible effects on the leaves, flowers and

roots in response to early flooding were observed. After 24

h exposure, EG203 exhibited clear stress symptoms, such

as epinasty and senescence (i.e. chlorosis) in most of the

leaves and flowers; however, most leaves and flowers of

EG117 looked green and healthy in the pots (photos not

shown). The roots of EG203 appeared brownish in color

following 48 h of flooding while those of EG117 appeared

brownish only after 72 h of flooding. When significant

flooding-injury became apparent, the APX level of oxy-

radical production might have increased. The APX gene

was affected by flooding stress over different hours of

the treatment. The degree and speed of flooding-injury

were the result of an accumulation of APX transcripts.

Plant development plays a role in the regulation of APX

gene expression. Flooding stress imposed disturbances in

this expression, causing alterations in transcript profiles

of different tissues. APX gene was differently expressed

in plant tissues and spatially regulated in eggplants. APX

gene expression and regulation interacted with both plant

development and stress response. Flooding stress in

eggplant triggered a defense mechanism against oxidative

stress. Hence, APX defenses were concretely regulated

to ensure proper protection against ROS generated after

exposure to flooding.

Southern analysis of ECoRI-, HindIII-, and BamHI-

digested DNA was performed to estimate the copy number

of the APX gene. The result showed that two restriction

fragments from eggplant genomic DNA hybridized to the

APX cDNA clone (Figure 2). Among these two bands,

bands of high molecular size appeared less intense than the

faster migrating bands. The intensity of the hybridization

bands reflected the extent of hybridization due to fragment

similarity to the APX cDNA probe. The brighter band

represents a fragment bearing a greater similarity to the

probe than the faint band. Southern blot was repeated to

exclude these fragments with different intensities resulting

from partial digestion of genomic DNA. In short, two

highly homologous genes to APX genes may exist in

eggplants.

A cDNA of APX was cloned from eggplant, and the full

sequence was subsequently subjected to NCBI database

comparison using BLASTN algorithms. The sequence

showed very high homology to other known cytosolic

APXs, with the closest match to S. tuberosum (96%)

(Kawakami et al., 2002), S. lycopersicum (95%) (Gadea

et al., 1999), C. annuum (93%) (Schantz et al., 1995) and

N. tabacum (91%) (Ovar and Ellis, 1997). Therefore, the

isolated clone proved to be the most similar to cAPX of

the other plants in nucleotides sequence. The cloned APX

cDNA contains an open reading frame of 753 bp, which

was a cytosolic type in the eggplant (Figure 7). Most full-

length APX cDNAs cloned to data have been about 1,000

bp long, such as 1042 bp of maize (Bresegem et al., 1995),

1044 bp of strawberry (Kim and Chung, 1998), 1102 bp of

spinach (Webb and Allen, 1995), 1040 bp of tobacco (Ovar

and Ellis, 1997), 1040 bp of pea (Mittler and Zilinskas,

1992), 1046 bp of sweet potato (Park et al., 2004), and

1039 bp of potato (Kawakami et al., 2002).

cAPX is a dimer consisting of identical subunits with

a molecular mass of 28 kDa. It is localized in the cytosol

of both photosynthetic and non-photosynthetic tissues.

The function is still obscure although it has been reported

that RNA for cAPX was induced by environmental

stimuli such as heat stress. The cytosolic APX gene

transcript from pea strongly increased following treatment

with methyl viologen, drought stress, and heat stress

(Mittler and Zilinskas, 1992; Mittler and Zilinskas,

1994). Storozhenko et al. (1998) indicated that the heat

shock response was very fast in the case of cAPX1 in A.

thaliana, and this quick response to heat shock was due

to the existence of a heat shock element in the promoter

region of cAPX1. The expression of the cAPX gene in

rice was mediated by high temperature; furthermore, rice

seedlings previously subjected to high temperature showed

increased tolerance to chilling stress (Sato et al., 2001).

Yoshimura et al. (2000) reported that among the four APX

isozymes tested, the steady-state transcript level of cAPX

type markedly increased in response to high light stress

and paraquat treatment, but not in response to drought and

salt treatments. In the present report, we have measured

the level of transcription of the APX gene in different

plant tissues exposed to various flooding treatments,

and concluded that the transcript level of cAPX gene

increased under flooding stress. Under stress conditions,

more H

is generated in the microbody matrix and

readily diffuses into the cytosol. The gene expression for

cAPX is a response to environmental changes, resulting

in the protection of important cellular compartments from

oxidative stress and in strict control of the level of H

in intercellular signaling. APX has a high affinity to H

and therefore is able to scavenge it. In plant cells, an

alternative and effective detoxification mechanism against

exists, operating both in chloroplasts and the cytosol.

In this detoxification mechanism, H

is reduced to H

with the ASA-GSH-NAPDH system catalyzed by APX

(Asada, 1992) in addition to catalase. The regulation of

APX gene expression by H

has been reported by Lee

et al. (1999). They concluded that treatment of cultured

soybean cells with exogenous H

resulted in the

alteration of cytosolic APX transcription levels.

pg_0008

Botanical Studies, Vol. 48, 2007

A phylogenetic tree constructed using the deduced

amino acid sequences of APX from five species showed

the division of the sequences into two classes. Some

lineages appear to be conserved across plant species with

large evolutionary differences between them. Eggplant and

potato contain smaller-subunit APX sequences (64%) than

pepper and tobacco (99%). The APX gene from eggplant

and potato is highly conserved, suggesting that the

domestication of eggplant to potato substantially affects

the evolution of APX in these plants. The divergence of

APX genes is in the context of the phylogenetic separation

between Solanaceae. The diversity of APX genes is

probably an adaptive function to counteract the rapid

evolution of plants.

Shigeoka et al. (2002) demonstrated that APX isozyme

evolution in higher plants and algae can be divided into

four groups: cAPXI, cAPXII, chlAPX and mAPX. The

cAPXI, chlAPX and mAPX share common features

conserved among plant species while the cAPXII group

may have evolved from cAPX in species-species manner.

Genes encoding cAPX respond to stress-related signals

of a biotic or abiotic nature, and are believed to play key

roles in these processes. Phylogenetic analysis indicates

that in eggplant and potato the expression degree of cAPX

gene may correlate with flooding stress.

In conclusion, we cloned the full-length cDNA of

APX in eggplant. The transcripts regulated by flooding

stress encode cytosolic APX isoform, and the genome of

eggplant contained two related cAPX genes. Phylogenetic

relationships among the plant APX sequences were

separated into two classes. The results suggest that the

induction of APX during the flooding stress is affected

through a transcriptional mechanism. The differential

and coordinated tissue and genotype specific expressions

of APX gene occurred in response to flooding stress

conditions. This is consistent with our previous report

that plant roots under waterlogged conditions generate

that may then be removed by APX. The elevated

APX activity may be one factor adding to the increased

waterlogging tolerance of eggplant roots. The assessment

of transcript kinetic accumulation of APX may help to

propose new strategies to analyze APX gene knockout

or to engineer transgenic plant (ie. tomato) tolerance

to flooding stress. To our knowledge, this is the first

suggestion that APX-encoding gene expression in eggplant

is regulated by flooding stress.

Acknowledgements. This research was supported by the

National Science Council, Taiwan, ROC. The authors are

grateful to D.L. Lo, Z.Y. Chang, and numerous students

for assistance in the greenhouse at Chinese Culture

University.

LITERATURE CITED

Asada, K. 1992. Ascorba te peroxida se-hydrogen peroxide-

scavenging enzyme in plants. Physiol. Plant 85: 235-241.

Blokhina, O., E. Virolainen, and K.V. Fagerstedt. 2003.

Antioxidants, oxidative damage and oxygen deprivation

stress: a review. Ann. Bot. 91: 179-194.

Bresegem, F.V., R. Villarroel, V.M. Montagu, and D. Inze. 1995.

Ascorbate peroxidase cDNA from maize. Plant Physiol.

107: 649-650.

Doyle, J.J. and J.L. Doyle. 1990. Isolation of plant DNA from

fresh tissue. Focus 12: 13-15.

Ga dea, J.,V. Coneje ro, a nd P. Vera. 1999. De ve lopme nt al

regulation of a cytosolic ascorbate peroxidase gene from

tomato plants. Mol. Gen. Genet. 262: 212-219.

Hoffman, E., D. Milkowski, and E. Pichersky. 1991. Isolation

a nd ch ar ac te ri z at io n o f t om at o c DNA a nd g en om e

clones encoding the ubiquitin gene. Plant Mol. Biol. 17:

1189-1201.

Ishikawa, T., K. Sakai, K. Yoshimura, T. Takeda, and S.

S higeoka. 1996. cDNAs encoding spinach s tromal and

thyla koid-bound asc orbat e perxidase , differing in the

presence or absence of their 3’-coding region. FEBS Lett.

384: 289-293.

Jespersen, H.M., I.V.H. Kjersgard, L. Ostergaard, and

K.G.Welinder. 1997. S equence analys is of three novel

ascorbate peroxidases from Arabidopsis thaliana to

structure, function and evolution of seven types of ascorbate

peroxidase. Biochem. J 326: 305-310.

Kawakam i, S., Y. Mats umoto, A. Matsunaga, S . Ma yama,

and M. Mizuno. 2002. Mole cular cloning of as corbate

peroxidase in potato tubers and its response during storage

at low temperature. Plant Sci. 163: 829-836.

Karpinski, S ., C. Es coba r, B. Karpinska, G. Creis sen, and

P.M. Mullineaux. 1997. Photosynthetic electron transport

regulates the expression of cytosolic ascorbate peroxidae

genes in Arabidopsis during excess light stress. Plant Cell 9:

627-640.

Kim, J.I. and W.I. Chung. 1998. Molecular characterization of a

cytosolic ascorbate peroxidase in strawberry fruit. Plant Sci.

133: 69-77.

Kornyeyev, D., B.A. Logan., R.A. Allen, and A.S . Holaday.

2003. Effect of chloroplastic overproduction of ascorbate

peroxidase on photosynthesis and photoprotection in cotton

leaves subjected to low temperature photoinhibition. Plant

Sci. 165: 1033-1041.

Kubo, A., H. Saji, K. Tanaka, and N. Kondo. 1992. Cloning and

s equencing of a cDNA encoding ascorbate peroxidases

from Arabidopsis thaliana. Plant Mol. Biol. 18: 691-701.

Kumar, S ., K. Tamara, I.B. Jakobsen, and M. Neim. 2001.

MEGA: molecular evolutionary genetic analysis software.

Bioinformatics 17: 124-1245.

Lee, S.C., B.G. Kang, and S.E. Oh. 1999. Induction of ascorbate

peroxidas e by ethylene and hydrogen peroxide during

growth of cultured soybean cells. Mol. Cells 9: 166-171.

Lin, K.H., C.C. Weng, H.F. Lo, and J.T. Chen. 2004. Study of

the root antioxidative sys tem of tomatoes and eggplant

under waterlogged conditions. Plant Sci. 167: 355-365.

Lin, K.H., P.Y. Chao, C.M. Yang, W.C. Cheng, H.F. Lo, and T.R.

pg_0009

LIN et al. — Cloning APX gene from flooded eggplant

Chang. 2006. The effects of flooding and drought stresses

on the antioxidant constituents in sweet potato leaves. Bot.

Stud. 47: 417-426.

Mittler, R. and B.A. Zilinskas. 1992. Molecular cloning and

characterization of a gene encoding pea cytosolic ascorbate

peroxidase. J. Biol. Chem. 5: 21802-21807.

Mittler, R. and B.A. Zilinskas. 1994. Regulation of pea cytosolic

ascorbate peroxidase and other antioxidant enzymes during

the progression of drought stress following recovery from

drought. Plant J. 5: 397-405.

Morimura, Y., K. Iwamoto, T. Ohya, T. Igarashi, Y. Nakamura,

A. Kubo, K. Tanaka, and T. Ikawa. 1999. Light-enhanced

induction of ascorbate peroxidase in Japanese radish roots

during postgerminative growth. Plant Sci. 142: 123-132.

Murgia, I., D. Tarantion, C. Vannini, M. Bracale, S. Carravieri,

and C. Soave. 2004. Arabidopsis thaliana pl a nt s

overexpres sing thylakoidal a scorbate peroxidase show

increased resistance to paraquat-induced photooxidative

stress and to nitric oxide-induced cell death. Plant J. 38:

940-953.

Ovar, B.L . and B.E. Ellis. 1997. Transgenic tobacco plants

ex pre s s i ng an ti s e ns e R NA f or s yt os ol i c as c or ba te

peroxidase show increased susceptibility to ozone injury.

Plant J. 11: 1297-1305.

Panchuk, I.I.., R.A. Volkov, and L.F. Schoff. 2002. Heat stress

and heat shock transcription factor dependent expression

and activity of ascorbate peroxidase in Arabidopsis. Plant

Physiol. 129: 838-835.

Park, .S Y., S.H. Ryu, I.C. Jang, S.Y. Kwon, and S.S . Kwak.

2004. Molecular cloning of a cytosolic ascorbate peroxidase

cDNA from cell cultures of sweetpotato and its expression

in response to stress. Mol. Gen. Genomics 271: 339-346.

Rzhetsky, A. and M. Nei. 1992. A simple method for estimating

and testing minimum evolution trees. Mol. Biol. Evol. 9:

945-967.

Saitou, N. and M. Nei. 1987. The Neighbor-joining Method:

A new method for reconstructing phylogenetic trees. Mol.

Biol. Evol. 4: 406-425.

Santos, M., H. Gousseau, C. Lister, C. Foyer, G. Creissen, and

P. Mullineaux. 1996. Cytosolic ascorbate peroxidase from

Arabidops is thaliana is encoded by a s mall m ultigene

family. Planta 198: 64-69.

Sato, Y., T. Murakami, H. Funatsuki, H. S aruyama, and M.

Tanida. 2001. Heat shock-mediated APX gene expression

and protection against chilling injury in rice seedlings. J.

Exp. Bot. 52: 1-7.

S chantz, M.L., H. Schreiber, P. Guillemaut, and R. S chantz.

1995. Changes in ascorbate peroxidas e activities during

fruit ripeni ng i n Capsic um annuum. FE BS L ett. 358:

149-152.

S hi , W.M., Y. Mura mot o, A. Ueda, a nd T. Ta kabe . 2001.

Cloning of peroxisomal ascorbate peroxidase gene from

barley and enhanced thermotolerance by overexpressing in

Arabidopsis thaliana. Gene 273: 23-27.

Shigeoka, S., T. Ishikawa, M. Tamoi, Y. Miyagawa, Y. Yabuta,

a nd K. Yo us him ura . 20 02. Re gul at ion and func ti on

of as corba te peroxidas e is oenzyme s. J. E xp. Bot. 53:

1305-1319.

S torozhenko, S., P.D. Pauw, M.W. Montagu, D. Inze, and S.

Kus hnir. 1998. T he heat-shock element is a functional

component of the Arabidopsis APX1 gene promoter. Plant

Physiol. 118: 1005-1014.

Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin, and

D.G. Higgins. 1997. The CLUSTAL X windows interface:

flexible stragies for multiple sequence alignment aided by

quality analysis tools. Nucleic Acids Res. 5: 4876-4882.

Thompson, J.D., D.G. Higgins , and T.J. Gibson. 1994. The

CLUS TAL W: improving the sens itivity of progres sive

multiple sequence alignment through sequence weighting,

position-specific gap penalties and weight matrix choice.

Nucleic Acids Res. 22: 4673-4680.

Tseng, Y.T., H.F. Lo, and S.Y. Hwang. 2002. Genotyping and

as ses s ment of genetic re lations hi ps in eli te polycross

bre eding cultivars of s wee t potato in Taiwan based on

SAMPL polymorphisms. Bot. Bull. Acad. Sin. 43: 99-105.

Webb, R.P. and D.R. Allen. 1995. Isolation and characterization

of a cDNA for spinach cytosolic ascorbate peroxidase. Plant

Physiol. 108: 1325.

Yoshimura, K., Y. Yabuta, T. Ishikawa, and S. Shigeoka. 2000.

Expression of spinach ascorbate peroxidase isozymes in

response to oxidative stress. Plant Physiol. 123: 223-234.

Yamaguchi, K., M. Hayashi, and M. Nishimura. 1996. cDNA

cl onin g of thyl akoi d-bound as corba te peroxi das e in

pumpkin and its characterization. Plant Cell Physiol. 37:

405-409.

Zou, L.P., H.X. Li, B. Ouyang, J.H. Zhang, and Z.B. Ye. 2006.

Molecular cloning, expression and mapping analysis of a

novel cytosolic ascorbate peroxidase gene from tomato.

DNA Seq. 16: 456-461.

pg_0010

Botanical Studies, Vol. 48, 2007