Botanical Studies (2007) 48: 377-385.

*

Corresponding author: E-mail: gfy@firdi.org.tw; Tel:

+886-3-5223191 ext. 580; Fax: +886-3-5224171.

INTRODUCTION

Retrotransposons are found in most eukaryotes and

in some cases constitute a major part of the genome

(e.g. 40-50% of the human genome). They have been

divided into two subclasses based on their differences in

overall structure. LTR retrotransposons closely relate to

retroviruses and non-LTR retrotransposons, also called

LINE-like elements. All these elements use reverse

transcription to propagate. Non-LTR retrotransposons

have been found in many groups of eukaryotic organisms,

including mammals, insects, amphibians, plants, and also

fungi.

Five non-LTR retrotransposons have been characterized

in filamentous fungi, including Tad1-1 in Neurospora

crassa (Cambareri et al., 1994), MGR583 in Magnaporthe

grisea (Hamer et al., 1989), CgT1 in Colletotrichum

gloeosporioides (He et al., 1996), marY2N in Tricholoma

matsutake (Murata et al., 2001), and Mars1 in Ascobolus

immerses (Goyon et al., 1996) though the entire element

is not described for this last species. These non-LTR

retrotransposons usually contain two ORFs encoding gag-

like and pol-like proteins. Moreover, they generally have

poly (A) or A-rich regions at their 3¡¦ terminus and generate

truncation in 5¡¦ UTRs. Phylogenetic analysis of non-LTR

retrotransposons based on the RT (reverse transcriptase)

domain, the only sequence found in all elements, defined

eleven clades by Malik et al. (1999). More recently, Burke

et al. (2002) proposed an additional classification in which

the various clades fall into five groups on the basis of both

the phylogenetic relationship of their RT sequence and the

nature and arrangement of their protein domains. Based

on sequence, structure, and phylogenetic analyses, the

non-LTRs elements from filamentous fungi are grouped in

the Tad1 clade. Recently, two non-LTR retrotransposons

of yeast, Zorro in Candida albicans (Goodwin et al.,

2001) and Ylli in Yarrowia lipolytica (Casaregola et al.,

2002), have been placed into the L1 clade of mammalian

elements.

According to the distribution of CgT1 in C .

gloeosporioides, the presence or absence of CgT1 can be

used to distinguish biotypes A and B that cause different

anthracnose diseases on Stylosanthes in Australia (He

et al., 1996). Moreover, DNA fingerprint analysis of

CgT1 reveals that Australian isolates of biotype B are

monomorphic. In addition, the analysis of the genetic

relations and evolutionary history of many species has

been facilitated by repetitive DNA fingerprinting probe

(Cizeron et al., 1998; Blesa et al., 2001; Daboussi and

Capy, 2003).

Characterization of MRT, a new non-LTR retrotransposon

in Monascus spp.

Yi-Pei CHEN

1,2

, Ching-Ping TSENG

2

, Li-Ling LIAW

1

, Chun-Lin WANG

1

, and Gwo-Fang YUAN

1,

*

1

Bioresource Collection and Research Center, Food Industry Research and Development Institute, P.O. Box 246, HsinChu

300, Taiwan

2

Department of Biological Science and Technology, National Chiao Tung University, HsinChu, Taiwan

(Received October 11, 2006; Accepted June 25, 2007)

ABSTRACT

. A new non-LTR retrotransposon, named MRT, was discovered in the filamentous fungus

Monascus pilosus BCRC38072. The entire nucleotide sequence of the MRT element was 5.5-kb long,

including two open reading frames. These two ORFs showed homologies to gag-like and pol-like gene

products, and an A-rich sequence at the 3¡¦ end of pol-like gene. ORF1 encoded a protein of 517 amino acids

and contained a cysteine-rich zinc finger motif. ORF2 encoded a protein of 1181 amino acids and contained

apurinic/apyrimidinic endonuclease (APE), reverse transcriptase (RT), RNaseH domains, and a CCHC motif.

The phylogenetic analyses demonstrated that the MRT element should be classified into the Tad1 clade. The

results of Southern hybridizations showed that MRT elements were distributed within M. pilosus, M. ruber, M.

sanguineus, and M. barkeri. In addition, the species of Monascus can be grouped by the presence or absence

of MRT elements in the hybridization pattern according to phylogenetic subgroups established with the partial

£]-tubulin gene.

Keywords: Bacterial artificial chromosome; Monascus pilosus; Non-LTR retrotransposon; Phylogenetic

analysis.

MOLeCULaR BIOLOgy

378

Botanical Studies, Vol. 48, 2007

Monascus spp. belongs to the ascomycetes, and has

been used in Chinese fermented foods such as anka, anka

pork, and rice wine for thousands of years. Thirteen

Monascus species have been reported. They are known

as producers of various secondary metabolites with

polyketide structures, such as monacolins, and have

medical importance (Endo, 1979). In this study, we report

the discovery of a new non-LTR retrotransposon named

MRT ( Monascus Retrotransposon) in Monascus spp. The

structural, genomic and phylogenetic analysis of the MRT

elements was presented. Moreover, the distribution of

MRT in Monascus species was also analyzed.

MaTeRIaLS aND MeTHODS

Strains, media, and growth conditions

The nineteen strains of Monascus listed in Table 1 were

used in this study. All strains were maintained on YM

(DIFCO, Detroit, Michigan) agar for one week, and spore

suspensions were obtained by washing cultured YM agar

plates with distilled water. Mycelia for DNA isolation

were harvested from YM broth after incubating for 8 days

at 28

o

C with constant agitation and then frozen at -80

o

C.

BaC library construction and shotgun

sequencing

The methods of Peterson et al. (2000) were used to

make a BAC library of Monascus pilosus BCRC 38072.

DNAs of eleven BAC clones were extracted for shotgun

sequencing by a Qiagen Large-Construct kit (Qiagen,

Valencia, CA). DNA sequencing was performed with an

ABI Prism 3700 Sequencer (Applied Biosystems, Foster

City, CA). The Phred-Phrap-Consed system developed

by the Phil Green Laboratory was used to assemble

DNA fragments (Gordon et al., 2001). Nucleotide and

deduced amino acid sequences were used to interrogate

the non-redundant database at GenBank using BlastN and

BlastX. Sequence analysis was done using VectorNTI 9.0

(InforMax, Frederick, MD) software. Prediction of nucleic

acid secondary structure was performed with Mfold

server (http://bioweb.pasteur.fr/seqanal/interfaces/mfold-

simple.html). The nucleotide sequences of MRT non-LTR

retrotransposons found in this study have been submitted

to GenBank under the accession numbers AY900582 and

DQ299897 to DQ299900.

genomic DNa preparation and Southern

hybridization

Monascus genomic DNA was extracted according to the

method developed by Bingle et al. (1999). Approximately

0.5 g (squeezed wet weight) of frozen mycelia was ground

to a fine power under liquid nitrogen using a mortar and

pestle. Protein was removed by successive rounds of

extraction with phenol and chloroform. Genomic DNA

Table 1. Strains used and GenBank accession numbers for the £]-tubulin gene.

Strain

Species

a

MRT non-LTR

retrotransposon

b

Accession number of £]-tubulin gene

BCRC 38072 (Taiwan isolate) Monascus pilosus

+

DQ299886

BCRC 31502 (ATCC 16363) Monascus pilosus, Type

+

AY498596

BCRC 31503 (ATCC 16364) Monascus pilosus

¡V

DQ299887

BCRC 31533 (ATCC 16246) Monascus ruber, Type

+

AY498589

BCRC 31523 (ATCC 16378) Monascus ruber

+

DQ299888

BCRC 31534 (ATCC 16366) Monascus ruber

+

AY498587

BCRC 31535 (ATCC 18199) Monascus ruber

+

DQ299889

BCRC 33314 (ATCC 16371) Monascus ruber

+

AY498588

BCRC 33323 (ATCC 18199) Monascus ruber

+

DQ299890

BCRC 31542 (ATCC 16365) Monascus purpureus, Type

¡V

DQ299891

BCRC 31541 (ATCC 16379) Monascus purpureus

¡V

AY498598

BCRC 31615 (DSM 1379)

Monascus purpureus

¡V

DQ299892

BCRC 33325 (IFO 30873)

Monascus purpureus

¡V

DQ299893

BCRC 31506 (CBS 302.78)

Monascus kaoliang, Type

¡V

DQ299894

BCRC 33446 (ATCC 200613) Monascus sanguineus, Type

+

AY498602

BCRC 33309 (ATCC 16966) Monascus barkeri

+

DQ299895

BCRC 33310 (IMI 282587)

Monascus floridanus, Type

¡V

DQ299896

BCRC 33640 (ATCC 204397) Monascus lunisporas, Type

¡V

AY498604

BCRC 33641 (ATCC 200612) Monascus pallens, Type

¡V

AY498601

a

"Type" indicates type strain.

b

+, presence of MRT non-LTR retrotransposon; ¡V, absence of MRT non-LTR retrotransposon.

CHEN et al. ¡X

Monascus pilosus

non-LTR retrotransposon

379

was recovered by precipitation with ethanol and dissolved

in TE buffer. For Southern hybridizations, genomic

DNA (7.5 £gg per lane) was digested with EcoRI and

BamHI restriction enzymes and separated through 1.0%

agarose gels by electrophoresis. Southern hybridization

analysis was performed using the DIG system (Roche

Diagnostics, Mannheim, Germany). The probe of the

MRT element was labeled by PCR amplification from

genomic DNA of M. pilosus 38072 using a PCR DIG

probe synthesis kit (Roche Diagnostics, Mannheim,

Germany). The primer set of the MRT probe was MRT1-

1F: CAGGGGGAGGCTAGGATGTA, and MRT1-1R:

CACAGGTGGGTAGAGCCACAG. All other DNA

manipulations were performed as described in Sambrook

et al. (1989).

Phylogenetic analysis

In addition to MRT element, £]-tubulin gene was

chosen for phylogenetic analysis of Monascus spp. The

partial £]-tubulin genes were amplified with the primer

set, btubulinF: 5¡¦-CAACTGGGCTAAGGGTCATT and

btubulinR: 5¡¦-GTGAACTCCATCTCGTCCATA (Wu et

al., 1996; Park et al., 2004). Sequences of partial £]-tubulin

genes obtained from Monascus strains used in this study

have been submitted to GenBank under the accession

numbers DQ299886 to DQ299896. The other accession

numbers of partial £]-tubulin genes, AY498587 to

AY498589, AY498596, AY498598, AY498601, AY498602

and AY498604, were obtained from the GenBank database.

The phylogenetic tree was constructed by the neighbor-

joining method (Saitou and Nei, 1987) using MEGA 3.1

software with 1000 bootstrap replicates.

ReSULTS aND DISCUSSION

During the whole genome sequencing of M. pilosus

BCRC38072, two repetitive sequences (mps01-1 and

mps01-2) were observed in a ca. 160 kb BAC, mps01.

They were found to have a homology similar to CgT1

(He et al., 1996), a non-LTR retrotransposon from

Colletotrichum gloeosporioides (mps01-1, 31% identity

and mps01-2, 32% identity by BlastX). The sequence

homology indicated that the repetitive sequences

were non-LTR retrotransposons. The new non-LTR

retrotransposon was designated MRT. Eleven BAC clones

of M. pilosus BCRC38072 were sequenced covering 1.55

Mb; and six positive BACs were identified, and 15 copies

of the MRT element were found in determining the relative

abundance and diversity of the non-LTR retrotransposon.

The entire nucleotide sequence of the MRT element

was 5.5-kb long. Given that the size of the M. pilosus

BCRC38072 genome was ~30 Mb, the number of copies

of the genome was estimated to be ~290, which occupied

about 5% of the M. pilosus BCRC38072 genome.

The translation frames of the entire set of MRT

elements revealed that four of them in BACs¡Xmps02-1,

mps07-1, mps11-1, and mps13-1¡Xcontained two

open reading frames (Figure 1), like other non-LTR

retrotransposons that have been found in fungi, CgT1,

Tad-1, and MGR583 (Hamer et al., 1989; Cambareri et

al., 1994; He et al., 1996). Numerous stop codons were

found in other copies of the MRT elements. A conceptual

translation demonstrated that the first ORF in the MRT

element may encode a protein of 517 amino acids. The

deduced amino acid sequence of the MRT ORF1 contained

one zinc finger motif that was cysteine-rich (Figures 1

and 2). The arrangement of cysteines indicated that the

consensus sequence CX

6

HXCX

6

CHX

2

HX

6

C represented

an NF-X1-type zinc finger, based on Pfam analysis (Song

et al., 1994). However, no 5¡¦ UTR was clearly identified,

suggesting that all of the active element may be rare

in M. pilosus BCRC38072. A conceptual translation

demonstrated that the second ORF in the MRT element

may encode a protein of 1181 amino acids. The ORF1

and ORF2 overlapped by 1 bp. The deduced amino

acid sequence of the MRT ORF2 contained an apurinic/

apyrimidinic endonuclease (APE) domain, a reverse

transcriptase (RT) domain, an RNaseH domain, and a

CCHC motif (Figures 1 and 3). The APE domain at the

N-terminal of ORF2 in the MRT element was proven

not to be well conserved in other organisms. The RT

domain located downstream of the APE domain contained

conservation of the deduced amino acid sequences,

YXDD, which were a part of the active site in the RT

domain (He et al., 1996). The 3¡¦ UTRs of the MRT

elements were around 300 bp, and the 3¡¦ ends were well

conserved. Two parts, the A-rich sequence and the stem-

loop region, were present in the conserved tail (Figure 4A).

Interestingly, the A-rich stretch represented two sequences,

Figure 1. Structure of the MRT e l e m en t . S ch e m a ti c

representation of the structural organization of the filamentous

fungi non-LTR retrotransposons. Tad1-1, MGR583 and CgT1

in Neurospora crassa, Magnaporthe grisea and Colletotrichum

gloeosporioides were obtained from the GenBank database

using the following accession numbers, L25662, AF018033 and

L76205, respectively. Southern hybridization analysis of MRT

in the genomes of Monascus species hybridized with the probe

indicated by small black bar. The abbreviation of CYS indicated

the cysteine-rich region, RNH indicated the RNaseH, AP E

indicated the apurinic/apyrimidinic endonuclease domain, RT

indicated the reverse transcriptase domain, and CCHC indicated

the Cys-His region.

380

Botanical Studies, Vol. 48, 2007

Figure 3. Mul t i pl e a l i gn m e nt o f

deduced amino acid sequences of the

MRT elements with related organisms.

Comparison of the N-termial apurinic/

ap yrim i dini c end onuc le as e (AP E )

do m a i n s b a s e d on a n a l i g n m e n t

of ap pro xi ma t el y 210 am i no a ci d

residues. Comparison of the reverse

transcriptase (RT) domain. Conserved

YXDD residues, active site of reverse

transcriptase domain, were indicated

above the ali gnm ent. Com pa ris on

of the RNaseH domains based on an

alignment of approximately 130 amino

acid residues. Conserved residues of

RNaseH were described by Malik et al.

(1999). Comparison of the C-terminal

Cys-His region (CCHC). Conserved

CX

1

CX

7

HX

3

C res idues, putative zinc

fi ng er of t he MRT e le m e nt , we re

indicated above the alignment.

Figu re 2. Deduced Am ino

ac id s eq uenc es al ignm en t

o f t h e M R T e l e m e n t s

ORF 1. The cys te ine -ric h

nucleotide-binding dom ain

re pre s ent e d a zi nc fi nge r

with the consensus sequence

CX

6

HXCX

6

CHX

2

HX

6

C

shown boxed.

CHEN et al. ¡X

Monascus pilosus

non-LTR retrotransposon

381

TAAATAATAA(CATAA)n and TAAATAATAA(A)n.

Additionally, the RNA transcribed from the conserved tail

of the MRT element was proposed to form a stem-loop

(Figure 4B). This stem-loop region can be recognized by

the reverse transcriptase of the non-LTR retrotransposon

(Baba et al., 2004). Furthermore, most non-LTR

retrotransposons have target site duplications (TSDs) of

variable lengths from 4 to 49 bp (Eickbush, 1992). The

sequence results also revealed that four MRT elements

presented 7 to 15 bp target site duplications (Figure 4C).

Since reverse transcriptase (RT) is a fundamental

component of the machinery required to synthesize

DNA, it is strongly conserved and used in analyses

of retrotransposon phylogeny (Flavell, 1995). In

particular, the eleven conserved block sequences of

the reverse transcriptase domain defined by Malik et

al. (1999) are extensively used for the construction of

retrotransposon phylogeny. This study analyzed the

phylogenetic relationships between members of the non-

LTR retrotransposons, including the four MRT elements

described above, using shared reverse transcriptase

domains. The phylogenetic tree was rooted using

Figure 4. (A) Comparison of 3¡¦ conserved region of the MRT

elements from BACs. The A-rich sequences and stem-loop were

marked. (B) Putative secondary structure of 3¡¦ conserved region

of the MRT element RNA as indicated in (A) was depicted. (C)

S equences at the ends of the MRT elements . F our elements

from BACs were shown. Putative target site duplications were

indicated by underlining.

Figure 5. Phylogenetic tree of non-LTR retrotransposons from

M. pilosus and various organisms. (A) The phylogeny of non-

LTR retrotransposons based on the eleven conserved blocks

of the revers e transcriptas e domains defined by Malik et al.

(1999) was constructed. The nucleotide sequences of MRT

non-LTR retrotransposons were used in this study under the

accession numbers DQ299897 to DQ299900. The tree was

rooted us ing RT s equences of bacterial and fungal group II

introns with L actococcus lactis (P 0A3U0), Escher ichia coli

(NP053121), Sinorhizobium meliloti (CAC49872) Neurospora

crassa (NP041729), Saccharomyces cerevis iae (NP009310),

and Schizosaccharomyces pombe (S78199). (B) The phylogeny

of non-LTR retrotransposons based on an alignment of

approximately 210 amino acid residues of apurinic/apyrimidinic

endonucle as e (AP E) dom ain. Acce ss ion numbe rs for the

apurinic /apyrim idinic e ndonuc leas e us ed as the outgroup

following: Drosophila sp. (AAB19427), and Escherichia coli

(P09030). Bootstrap values were shown in the nodes according

to the 1000 replications. Only bootstrap values >50 were shown.

The tree was constructed by the neighbor-joining method (Saitou

and Nei, 1987).

RT sequences of bacterial and fungal group II introns

(Xiong and Eickbush, 1990). Eleven clades were clearly

distinguished (Figure 5A). This result was consistent with

the phylogeny constructed by Malik et al. (1999). The

phylogenetic tree further suggested that the MRT element

belonged to the Tad1 clade known from filamentous

fungi. Moreover, the apurinic/apyrimidinic endonuclease

(APE) domain is believed to cleave DNA in the reverse

transcription reaction at the chromosome target site (Maita

et al., 2004) and is commonly employed to construct the

phylogenetic analysis (Malik et al., 1999). Since CRE,

382

Botanical Studies, Vol. 48, 2007

R2 and R4 clades lacked an APE domain, other clades

were applied to construct a phylogenetic tree that was

rooted using the apurinic/apyrimidinic endonuclease

of Drosophila sp. (AAB19427), and Escherichia coli

(P09030). Figure 5B depicts the phylogenetic tree of the

non-LTR retrotransposons according to the APE domain. It

demonstrates that the close relationship between members

of the Tad1 clade is consistent with the phylogeny

obtained from the reverse transcriptase domain. The APE

phylogeny had lower resolution than the RT phylogeny,

perhaps because that APE domain was smaller and less

conserved than the RT domain (Malik et al., 1999).

Additionally, even though the APE and RT domains of

CgT1 contained termination codons in the ORF1 and

ORF2 (He et al., 1996), the phylogeny analysis of the

deduced amino acid sequence of the CgT1 element also

revealed that belonged to the Tad1 clade.

In order to study the distribution of MRT elements

in Monascus species (Table 1), their genomic DNA was

extracted and digested by EcoRI and BamHI. The results

of Southern hybridization showed that the MRT elements

were widely distributed over M. pilosus, M. ruber and M.

barkeri (Figure 6), and a large number of high-intensity

bands were detected in these species. In contrast, the

MRT element was absent in the species of M. purpureus,

M. kaoliang, M. floridanus, M. lunisporas, and M. pallens.

The intensity and diversity of hybridization patterns

also shown in M. sanguineus, a newly found species of

Monascus, were weaker than those in the species of M.

pilosus, M. ruber, and M. barkeri. The weaker intensity

of bands implied that the copy number of MRT in M.

sanguineus was lower than in M. ruber, M. pilosus, and

M. barkeri. The fingerprints of the DNA hybridizations

demonstrated that the band patterns were distributed

between 500 bp to 10 kb. However, the species M .

pilosus BCRC31503 was an exception that could not

detect the presence of any MRT elements (Figure 6). A

phylogenetic characterization using the partial £]-tubulin

gene as a molecular differentiation marker was conducted

to elucidate the evolutionary history of MRT elements

among different species. According to the study of Park

et al. (2004), the partial £]-tubulin gene can be adopted

to examine the phylogenetic relationship among the

Monascus species without gaps in the alignment of partial

£]-tubulin genes. Aspergillus flavus (M38265), Aspergillus

parasiticus (L49386), Aspergillus fumigatus (AY048754)

and Penicillium digitatum (D78154) were used as

outgroups of phylogenetic analysis. Interestingly, the

result of the phylogenetic analysis of the partial £]-tubulin

gene showed that M. pilosus BCRC31503, M. purpureus,

and M. kaoliang were placed into the same clade (Figure

7). This finding was in agreement with the results obtained

by grouping species into a Southern hybridization pattern

by the presence or absence of MRT elements. Therefore,

M. pilosus BCRC31503 may have been misidentified and

should be reconsidered as M. purpureus. Since M. pilosus,

M. ruber, an d M. barkeri could not be differentiated

using the partial £]-tubulin genes, three species have been

suggested to be synonymous, meaning that they should be

classified as a single species. DNA hybridization among

Figure 6. Southern hybridizations analyses of the MRT elements. Chromosome DNAs extracted from Monascus species were digested

by EcoRI (A) and BamHI (B) separated on electrophoresis gel and hybridized respectively with 422-bp probe. Monascus species¡X

lane 1: M. pilosus BCRC38072; lane 2: M. pilosus BCRC31502; lane 3: M. pilosus BCRC31503; lane 4: M. ruber BCRC31533; lane

5: M. ruber BCRC31523; lane 6: M. ruber BCRC31534; lane7: M. ruber BCRC31535; lane 8: M. ruber BCRC33314; lane 9: M. ruber

BCRC33323; lane 10: M. purpureus BCRC31542; lane 11: M. purpureus BCRC31541; lane 12: M. purpureus BCRC31615; lane 13:

M. purpureus BCRC33325; lane 14: M. kaoliang BCRC31506; lane 15: M. sanguineus BCRC33446; lane 16: M. barkeri BCRC33309;

lane 17: M. floridanus BCRC33310; lane 18: M. lunisporas BCRC33640; lane 19: M. pallens BCRC33641.

CHEN et al. ¡X

Monascus pilosus

non-LTR retrotransposon

383

Monascus species (our unpublished data) also supported

the identity of M. pilosus and M. ruber. The other genetic

markers have been found to distinguish Monascus species

using the D1/D2 region of the large subunit (LSU) rRNA

genes (Park and Jong, 2003) and the ITS region (Park et

al., 2004). These results also demonstrate that M. ruber

and M. pilosus could not be differentiated. Moreover, the

MRT non-LTR retrotransposons were widely distributed

over M. pilosus and M. ruber. Hence, the two species

were determined to be synonymous. In the taxonomy

o f Monascus (Hawksworth and Pitt, 1983), M. barkeri

goes by the name of M. ruber. The results herein were

consistent with their theory. Furthermore, M. sanguineus

was placed on a branch that was separate from M .

pilosus, M. ruber, and M. barkeri, while the difference

of phylogenetic distance corresponded to the results of

Southern hybridization with varying intensities of the

bands of M. pilosus, M. ruber, and M. barkeri.

According to the phylogenetic subgroups established

with the partial £]-tubulin gene, the species were grouped

by the presence or absence of MRT elements in the

hybridization pattern (Figure 7). Since the MRT element

was only detected in M. pilosus, M. ruber, M. barkeri and

M. sanguineus, the MRT element was suggested to have

been present in the ancestors of the Monascus species,

and absent from most other species or to have diverged

from M. pilosus. This phenomenon may have been caused

by the genetic drift that is itself associated with small

effective populations, which are responsible for an increase

in the numbers of copies of elements in some species and

a decline in others (Cizeron et al., 1998; Le Rouzic and

Capy, 2005). However, horizontal transfer (HT) has been

observed with the variable distribution of retrotransposons

between different classes, phyla, or kingdoms. The

horizontal transfer is believed to be present in members

of the RTE clade (.upunski et al., 2001). Bov-B LINEs

of the RTE clade exhibit a very low divergence between

Ruminantia and Squamata, strongly indicating horizontal

transfer. In this study, the result with the various species

of Monascus revealed that MRT non-LTR retrotransposon

was restricted to M. sanguineus, M. pilosus, M. ruber,

and M. barkeri, the last three species of which were

synonymous. These observations suggested that the MRT

element was introduced into the ancestor of the Monascus

species, and then diverged into M. sanguineus, M.

pilosus, M. ruber, and M. barkeri. Although the evidence

for horizontal transfer events is present in non-LTR

retrotransposons of RTE clade, different taxonomic groups

must be sampled to determine whether the horizontal

transfer events also occurred in the Tad1 clade.

Transposable elements may be regarded as genetic

components that evolve in an ecological community of the

host genome (Brookfield, 1995). During evolution, the

spread and distribution of the elements depend on not only

their ability to amplify, but also the complex interactions

between various families of elements, and between the

elements and the hosts (Tu et al., 1998). Analyses of

endogenous retrotransposable elements in Monascus

species can be potentially used as markers in genetic

mapping and in population studies. MRT was consistent

with CgT1, which can distinguish between two groups

based on presence or absence of non-LTR retrotransposon

(He et al., 1996). Practically, our findings indicate that

MRT has great potential in strain characterization and in

studies of population structure and evolution in Monascus

spp.

Acknowledgments. Support of the Ministry of Economic

Affairs, Taiwan, ROC, (Grant No. 94-EC-17-A-

17-R7-0563) to FIRDI is appreciated.

LITeRaTURe CITeD

Baba, S., M. Kajikawa, N. Okada, and G. Kawai. 2004. Solution

structure of an RNA stem-loop derived from the 3¡¦

conserved region of eel LINE UnaL2. RNA 10: 1380-1387.

Bingle, L.E.H., T.J. Simpson, and C.M. Lazarus. 1999.

Ketosynthase domain probes identify two subclasses of

fungal polyketide synthase genes. Fungal Genet. Biol. 26:

209-223.

Blesa, D., M. Gandia, and M.J. Martinez-Sebastian. 2001.

Dis tributi on of t he bilbo non-LT R re trotrans poson in

Drosophilidae and its evolution in the Drosophila obscura

Figure 7. Phylogeny of Monascus species based on the partial

£]-tubulin gene amplified by PCR. The partial £]-tubulin genes

were used by the following accession numbers, DQ299886 to

DQ299896, AY498587 to AY498589, AY498596, AY498598,

AY498601, AY498602 and AY498604. Acces sion numbers

for the £]-tubulin genes were used as the outgroup following:

Aspergillus flavus (M38265), Aspergillus parasiticus (L49386),

Aspergillus fumigatus (AY048754), and Penicillium digitatum

(D78154). Bootstrap values were shown in the nodes according

t o t he 1000 replicat ions . Only boot strap values >50 were

s hown. T he tree was cons tructed by the neighbor-joining

m ethod (Saitou and Nei, 1987). + MRT: pres ence of MRT

non-LTR retrotransposon; ¡V MRT: absence of MRT non-LTR

retrotransposon.

384

Botanical Studies, Vol. 48, 2007

species group. Mol. Biol. Evol. 18: 585-592.

Brookfield, J.F. 1995. Molecular evolution. Retroposon revivals.

Curr. Biol. 5: 255-256.

Burke, W.D., H.S. Malik, S.M. Rich, and T.H. Eickbush. 2002.

Anc ient l ineage s of non-LT R retrotra nspos ons in the

primitive eukaryote, Giardia lamblia. Mol. Biol. Evol. 19:

619-630.

Cambareri, E.B., J. Helber, and J.A. Kinsey. 1994. Tad1-1, an

active LINE-like element of Neurospora crassa. Mol. Gen.

Genet. 242: 658-665.

Casaregola, S., C. Neuveglise, E. Bon, and C. Gaillardin. 2002.

Ylli, a non-LTR retrotransposon L1 family in the dimorphic

yeast Yarrowia lipolytica. Mol. Biol. Evol. 19: 664-677.

Cizeron, G., F. Lemeunier, C. Loevenbruck, A. Brehm, and

C. Biemont. 1998. Distribution of the retrotransposable

element 412 in Drosophila s pecies. Mol. Biol. Evol. 15:

1589-1599.

Daboussi, M.J. and P. Capy. 2003. Transposable elements in

filamentous fungi. Annu. Rev. Microbiol. 57: 275-299.

Eickbush, T.H. 1992. Transposing without ends: the non-LTR

retrotransposable elements. New Biol. 4: 430-440.

Endo, A. 1979. Monacolin K, a new hypocholesterolemic agent

produced by a Monascus species. J. Antibiot. (Tokyo) 32:

852-854.

Flavell, A.J . 1995. Retroelements, reverse trans criptas e and

evolution. Comp. Biochem. Physiol. 110: 3-15.

Goodwin, T.J., J.E. Ormandy, and R.T. P oulter. 2001. L1-like

non-LTR retrotransposons in the yeast Candida albicans.

Curr. Genet. 39: 83-91.

Gordon, D., C., Desmarais, and P. Green. 2001. Automated

finishing with autofinish. Genome Res. 4: 614-625.

Goyon, C., J.L. Rossignol, and G. Faugeron. 1996. Native DNA

repeats and methylation in Ascobolus. Nucleic. Acids. Res.

24: 3348-3356.

Hame r, J .E ., L. Fa rrall, M.J . Orba ch, B. Vale nt, and F.G.

Chumley. 1989. Host species-specific cons ervation of a

family of repeated DNA s equences in the genome of a

fungal plant pathogen. Proc. Natl. Acad. S ci. US A 86:

9981-9985.

Hawksworth, D.L. and J.I. P itt. 1983. A new taxonomy for

Monascus s pecies based on cultural and micros copical

characters. Aust. J. Bot. 31: 51-65.

He, C., J.P. Nourse, S. Kelemu, J.A. Irwin, and J.M. Manners.

1996. CgT1: a non-LTR retrotransposon with restricted

distribution in the fungal phytopathogen Colletotrichum

gloeosporioides. Mol. Gen. Genet. 252: 320-331.

Le Rouzic, A. and P. Capy. 2005. The first steps of transposable

e lements invasion: parasi tic strate gy vs . ge ne tic drift.

Genetics 169: 1033-1043.

Maita, N., T. Anzai, H. Aoyagi, H. Mizuno, and H. Fujiwara.

2004. Crystal structure of the endonuclease domain encoded

by the telomere-specific long interspersed nuclear element,

TRAS1. J. Biol. Chem. 279: 41067-41076.

Malik, H.S., W.D. Burke, and T.H. Eickbush. 1999. The age

and evolution of non-LTR retrotransposable elements. Mol.

Biol. Evol. 16: 793-805.

Murata, H., Y. Miyazaki, and A. Yamada. 2001. marY2N, a

LINE-like non-long terminal repeat (non-LTR) retroelement

from the ectomycorrhizal homobasidiomycete Tricholoma

matsutake. Biosci. Biotechnol. Biochem. 65: 2301-2305.

Park, H.G., E.K. Stamenova, and S-C Jong. 2004. Phylogenetic

relationships of Monascus species inferred from the ITS

and the partial £]-tubulin gene. Bot. Bull. Acad. Sin. 45:

325-330.

Park, H.G. and S.-C. Jong. 2003. Molecular characterization of

Monascus strains based on the D1/D2 regions of LSU rRNA

genes. Mycoscience 44: 25-32.

Peterson, D.G., J.P. Tomkins, D.A. Frisch, R.A. Wing, and A.H.

Paterson. 2000. Construction of plant bacterial artificial

chromosome (BAC) libraries: An illustrated guide. J. Agric.

Genomics. Volume 5.

Saitou, N. and M. Nei. 1987. The neighbor-joining method: a

new method for reconstructing phylogenetic trees. Mol.

Biol. Evol. 4: 406-425.

S ambrook, J., E. Fritsch, and T. Maniatis. 1989. Molecular

cloning: a laboratory manual. Cold Spring Harbor, Cold

Spring Harbor Laboratory Press, New York.

S ong, Z., S. Krishna, D. Thanos, J .L. Strominger, and S .J .

Ono. 1994. A novel cysteine-rich sequence-specific DNA-

binding protein interacts with the conserved X-box motif

of the human major his tocompatibility complex clas s II

genes via a repeated Cys-His domain and functions as a

transcriptional repressor. J. Exp. Med. 180: 1763-1774.

Tu, Z., J. Isoe, and J.A. Guzova. 1998. Structural, genomic,

and phylogenetic analysis of Lian, a novel family of non-

LTR retrotransposons in the yellow fever mosquito. Aedes

aegypti. Mol. Biol. Evol. 15: 837-853.

Wu, T.S., C.D. Skory, J.S. Horng, and J.E. Linz. 1996. Cloning

and functional a nalys is of a bet a-tubulin gene from a

benomyl resistant mutant of Aspergillus parasiticus. Gene

182: 7-12.

Xiong, Y. a nd T.H. Ei ckbush. 1990. Origin and evolut ion

of retroelements based upon their reverse transcriptase

sequences. EMBO J. 9: 3353-3362.

.upunski, V., F. Guben.ek, and D. Kordi.. 2001. Evolutionary

dynamics and evolutionary history in the RTE clade of non-

LTR retrotransposons. Mol. Biol. Evol. 18: 1849-1863.

CHEN et al. ¡X

Monascus pilosus

non-LTR retrotransposon

385