Botanical Studies (2009) 50: 137-147.

6

Present address: Department of Plant Pathology and

Microbiology, Texas A & M University, College Station, TX

77840, USA.

*

Corresponding author: E-mail: Peter.Ueng@ars.usda.

gov; ppuuueng@gmail.com; Tel: +1-301-504-6308; Fax:

+1-301-504-5449.

INTRODUCTION

Length polymorphisms in the ribosomal RNA (rRNA)

genes are due to DNA fragment insertions, deletions,

duplications and the presence of group I introns. Group

I introns are one of the major class introns widespread

in mitochondria, chloroplasts and nuclear rDNA of

eukaryotes including fungi, algae, slime molds and plants,

and in eubacteria and protist (Turmel et al., 1991; Haugen

et al., 2005). Group I introns are also infrequently reported

in mitochondrial genomes of lower sea animals, viruses

and phages, and absent in prokaryotes including archaea

and bacteria (Lonergan and Gray, 1994; Beagley et al.,

Group I introns in small subunit ribosomal DNA (SSU-

rDNA) of cereal Phaeosphaeria species

Chih-Li WANG

1,6

, Pi-Fang Linda CHANG

2

, Ying-Hong LIN

2

, Arkadiusz MALKUS

3

, Ling-Yan

GAO

4

and Peter P. UENG

5,

*

1

Department of Plant Protection, Fengshan Tropical Horticultural Experiment Station, Agricultural Research Institute,

Kaohsiung 830, Taiwan

2

Department of Plant Pathology, National Chung Hsing University, Taichung 402, Taiwan

3

Department of Plant Pathology, Plant Breeding and Acclimatization Institute, Radzikow, Poland

4

Inner Mongolia Agriculture University, College of Ecology and Environmental Science, Inner Mongolia

5

Molecular Plant Pathology Laboratory, Plant Science Institute, U.S. Department of Agriculture, ARS, Beltsville, MD

20705, USA

(Received May 14, 2008; Accepted November 20, 2008)

ABSTRACT.

In a study of small subunit ribosomal RNA (SSU-rRNA) gene sequences in cereal and a grass

Phaeosphaeria species, group I introns were found in 9 of 10 P. avenaria f. sp. avenaria (Paa) isolates from

oat (Avena sativa L.), 1 of 2 Phaeosphaeria sp. (P-rye) isolates (Sn48-1) from Polish rye (Secale cereale L.), 1

Phaeosphaeria sp. (P-dg) isolate (S-93-48) from dallis grass (Paspalum dilatatum Poir.) and both heterothallic

P. a. f. sp. triticea (Pat2) isolates (ATCC26370 and ATCC26377) from foxtail barley (Hordeum jubatum L.).

There were no group I introns in wheat- and barley-biotype P. nodorum (PN-w and PN-b), homothallic P.

a. f. sp. triticea (Pat1) and P. a . f. sp. triticea (Pat3) from the state of Washington. Based on the reference

16S rDNA nucleotide sequence of Escherichia coli (accession number J01695), the intron-inserted positions

of Pav.nS943, Pse.nS943, Ppa.nS1199 and Pho.nS1533 were determined to be at nt943, nt943, nt1199 and

nt1533, respectively. The sizes of the introns were 362 bp for Pav.nS943 (from Paa), 363 bp for Pse.nS943 (from

P-rye), 460 bp for Pho.nS1533 (from Pat2) and 383 bp for Ppa.nS1199 (P-dg). The intron-inserted position at

nt1533 found in SSU-rRNA of Pat2 pathogen was newly discovered. The phylogenetic relationships based on

aligned conserved secondary structure component sequences of group I introns showed that three introns from

cereal Phaeosphaeria species (Pav.nS943, Pse.nS943 and Pho.nS1533) were likely affiliated with subgroup

IC1 introns while Ppa.nS1199 intron from the dallis grass pathogen belonged to subgroup IE3.

Keywords: Introns; Phaeosphaeria; Phylogenetic relationships; Ribosomal RNA gene; Small subunit; Wheat.

1998; Nishida et al., 1998; Riipinen and Alatossava,

2004; Sandegren and Sjoberg, 2004; Fukami et al.,

2007; Stankovic et al., 2007). Some group I introns are

experimentally proven to act as mobile genetic elements

by reverse splicing and site-specific endonuclease

restriction (Lambowitz and Belfort, 1993; Saldanha et al.,

1993; Belfort and Perlman, 1995; Roman and Woodson,

1998; Haugen et al, 2005).

The insertion positions of group I introns in nuclear

SSU-rRNA gene were standardized by using 16S rDNA

nucleotide sequence of Escherichia coli (Accession

number J01695) as reference. Group I introns with the

same insertion positions are suggested to have evolved by

vertical transmission, along with the occasional loss and

horizontal transfer (Nikoh and Fukatsu, 2001; Feau et al.,

2007). In vertical transfer, the phylogenetic relationship

of introns inserted at the same position is expected to be

significantly congruent with the phylogeny of their hosts

(Nikoh and Fukatsu, 2001). When the phylogeny of group

I introns differ significantly from the host genomes, it is

mOleCUlAR BIOlOGy

138

Botanical Studies, Vol. 50, 2009

a strong evidence of horizontal transfer (Goddard and

Burt, 1999; Holst-Jensen et al., 1999; Simon et al., 2005).

The presence of group I introns in rRNA in some fungal

species is useful in developing molecular markers for PCR

amplification to separate them from other species which

had no introns (Neuveglise et al., 1997; Chen et al., 1998).

In a preliminary survey, length polymorphisms

were observed in the small subunit ribosomal RNA

(SSU-rRNA) genes of several Phaeosphaeria species

(Anamorph: Stagonospora). The SSU-rRNA gene

sequence of P. avenaria f. sp. avenaria (Paa) AFTOL-ID

280 isolate containing an intron was deposited previously

(Accession number AY544725). Characteristics of these

length polymorphisms in SSU-rRNA of three cereal

and one grass Phaeosphaeria species were studied here.

This is the first report of a new group I intron inserted at

position nt1533 corresponding to the Escherichia coli 16S

rDNA found in P. avenaria f. sp. triticea (Pat2) pathogens

isolated from foxtail barley (Hordeum jubatum L.).

mATeRIAlS AND meTHODS

PCR amplification and sequencing

Procedures for fungal culture in a liquid medium and

for genomic DNA (gDNA) isolation were described

previously (Ueng et al., 1992). The gDNA was purified

by CsCl gradient ultracentrifugation. The primer

set NS1 (GTAGTCATATGCTTGTCTC) and NS8

(TCCGCAGGTGCACCTACGGA) designed from the

rDNA sequence (nt10138-nt10120 / nt8368-nt8387) of

Saccharomyces cerevisiae (Accession number Z73326)

were used for amplifying partial SSU fragments in strains

of Phaeosphaeria. Phaeosphaeria species including 5

wheat-biotype P. nodorum (PN-w), 6 barley-biotype P.

nodorum (PN-b), 10 P. avenaria f. sp. avenaria (Paa), 5

homothallic P. avenaria f. sp. triticea (P. a. f. sp. triticea,

Pat1), 2 heterothallic P. a. f. sp. triticea from foxtail barley

(Pat2), 1 P. a. f. sp. triticea from the state of Washington

(Pat3), 2 Phaeosphaeria sp. from Polish rye (P-rye)

(Reszka et al., 2006) and 1 from dallis grass (Paspalum

dilatatum Poir.) (P-dg) were used (Table 1). For examining

intron insertion in the large subunit ribosomal RNA

(LSU-rRNA) genes of those Phaeosphaeria species,

primers sets LR0R/LR7 (ACCCGCTGAACTTAAGC/

TACTACCACCAAGATCT), LR7R/LR10 (GCAGATCTT

GGTGGTAGTAG/GTCAAGCTCAACAGGGTCTTC)

and LR10R/LR13 (GAAGACCCTGTTGAGCTTGAC/

GATCGTAACAACAAGGCTACTC) were used for PCR

amplifications. PCR amplification was performed in 50 £gl

reaction mixtures containing reaction buffer (50 mM KCl,

10 mM Tris-HCl, pH 9.0 at 25¢XC, 0.1 % Triton X-100), 1.5

mM MgCl

2

, 0.2 mM dNTPs, 1.5 £gM of each primer, 80 ng

gDNA, and 1.0 unit of Ta q DNA polymerase (Promega,

Madison, WI). Reaction parameters were: denaturation (94

¢XC, 3 min) followed by 40 cycles of 94¢XC (20 s), 55¢XC (30

s), and 72¢XC (1 min), and a final incubation step at 72¢XC

(10 min). Isolation and direct sequencing of PCR products

were conducted as described previously (Ueng et al.,

2003).

Intron splicing in SSU rRNA

To determine the intron splicing in rRNA, the total RNA

digested with DNase I was used. Both gDNA and total

RNA were isolated from Phaeosphaeria cultures grown

in YMS (0.5% malt extract, 0.5% yeast extract and 2.0%

sucrose) liquid medium with shaking at 125 rpm for 7-14

days at 27¢XC (Ueng et al., 1992). The gDNA was partially

purified, ribonuclease A treated and without CsCl gradient

ultracentrifugation (Ueng et al., 1992). Extraction of total

RNA mainly followed the protocols previously described

(Wang et al., 2007). Lack of residual gDNA in total RNA

was evidenced by not being able to amplify the partial

histidinol dehydrogenase (Hdh1) gene fragment by the

primer set 15A/12-1 (ATGCCGGCAGGACCCAGTGA/

CTATCAAGCTACGCCAAGTCGC) and Ta q DNA

polymerase (Unpublished data, Wang et al., 2007).

The first strand (1¡Ñ) cDNA was synthesized with

random primers p(dN)

6

and the First Strand cDNA

Synthesis Kit (Roche Diagnostics Corporation,

Indianapolis, IN). PCR amplified fragments amplified

from gDNA and 1¡Ñ cDNA were isolated, sequenced

and compared (Ueng et al., 2003). Primers, NS1 and

NS8, and other specifically designed ones, such as Fun5

(GACCAGGACTTTTACTTTG), Fun6 (CTGTCAATCCT

TATTTCATCTG), Fun8 (GTGTTGAGTCAAATTAAGC)

and SR6 (TGTTACGACTTTTACTT), were used for

amplifying and sequencing partial SSU-rDNA fragments

from gDNA and the first strand cDNA.

Secondary structure modeling of group I

introns in pre-rRNA

The secondary structures of group I introns were

predicted and constrained according to the expected

conserved sequences and structures for subgroup IC

(Cech, 1988) and subgroup IE (Suh et al., 1999; Li and

Zhang, 2005) by utilizing the ¡¥RNA structure, version 4.4¡¦

program (Mathews et al., 1999, 2004) and exported in ¡¥.ct¡¦

format for further refinement with the ¡¥RnaViz 2¡¦ program

(De Rijk et al., 2003). The intron nomenclatures followed

Johansen and Haugen¡¦s proposal (2001) and the structural

conventions for group I introns followed Burke et al.

(1987) and Gutell (1993).

Subgroup introns by sequence analysis

Regardless of the exon sequences, the insertion

positions, and their host phylogenetic relationships, group

I introns were divided into 5 major groups (IA-IE), which

included 14 subgroups (IA1-AI3, IB1-IB4, IC1-IC3, ID,

and IE1-IE3). Most of group I introns in the nuclear SSU-

rDNA have been grouped in either IC1 or IE, whilst in

the organelle (mitochondria and chloroplast), SSU-rDNA

grouped in IA3 and IC2 except for 1 in IB1 (www.rna.

icmb.utexas.edu, Cannone et al., 2002). To identify sub

groupings of the introns found in the nuclear SSU-rDNA

WANG et al. ¡X Group I intron in rDNA

139

140

Botanical Studies, Vol. 50, 2009

of Phaeosphaeria species, 12 intron nucleotide sequences

representative of subgroup IC, IE, IB2 and IA3 were

randomly chosen from the alignments made by Michel &

Westhof (1990) and Li & Zhang (2005), manually aligned

with 4 Phaeosphaeria intron nucleotide sequences based

on the core secondary structure components P1 to P10,

and refined by removing the components P2, P2.1, P7.1,

P7.2, and P9.1 to P9.3, which are not presented in all

groups (Table 2). The final alignment data were analyzed

using Mega Version 4.0 (http://www.megasoftware.net/

index.html, Tamura et al., 2007). One thousand data sets

analyzed from 167 informative nucleotides sites were

generated by bootstrap re-sampling and evaluated by

Neighbor-Joint (NJ) method with Jukes-Cantor model.

ReSUlTS

Identification of the intron sequences in SSU-

rDNA

Partial SSU-rDNA fragments amplified from gDNA

with the primer set NS1/NS8 showed length variations in

several cereal Phaeosphaeria species (Figure 1A). There

were two DNA fragments produced in P-rye Sn48-1

isolate (Figure 1A, lane 6). Based on the nucleotide

sequences, group I introns were identified in the following

isolates: 9 of 10 Paa, 1 of 2 P-rye, both Pat2 and 1 P-dg

(Table 1). The analysis also showed that group I introns in

SSU-rDNA in Phaeosphaeria will be removed from the

pre-rRNA during rRNA maturation (Figure 1B). Without

group I introns, the length of partial SSU fragments

amplified by the primer set NS1/NS8 are expected to be

1,769 bp in Phaeosphaeria species. Pat1 and Pat3 had the

same nucleotide sequences for the partial SSU-rDNA as

that in PN-w. Compared to partial SSU-rDNA sequence

of PN-w, there is l nucleotide substitution in PN-b, 2 in

Paa and Pat2, 3 in P-dg and 4 in P-rye isolates (Data not

shown). The sizes of group I intron in SSU-rDNA were

as followed: 362 bp in Paa, 363 bp in P-rye, 460 bp in

Pat2 and 383 bp in P-dg isolates (Table 1). On the other

hand, partial nucleotide sequences of large subunit (LSU-)

rRNA gene amplifying with three primers sets LR0R/LR7,

LR7R/LR10 and LR10R/LR13 found no intron insertions

in those Phaeosphaeria species (Accession numbers

EF590318-EF590322 and EU223256-EU223257, Table 1).

Intron positions and naming

Based on the 1,542 bp-long reference 16S rDNA

sequence of E. coli (accession number J01695), the intron

positions were determined to be at nt943 for Paa and

P-rye, nt1199 for P-dg and nt1533 for Pat2 (Figure 2).

Since Paa (P. avenaria f.sp. avenaria) was first identified

as a pathogen from oat [Av ena sativa L.], the group I

intron found in this pathogen was named as Pav.nS943

following Johansen and Haugen¡¦s proposal (2001).

However, the scientific names and classification of P-rye,

Pat2 and P-dg pathogens have not yet been recognized.

In this paper, the first two letters of their respective host

WANG et al. ¡X Group I intron in rDNA

141

Figure 1. Amplification of partial small subunits of ribosomal DNA (SSU-rDNA) in Phaeosphaeria species. A, Partial SSU-

rDNA was amplified from the genom ic DNA (gDNA) with NS1/NS8 primer set. M = Molecular markers of £f DNA cut with

HindIII and EcoRI restriction enzymes. 1-2 = Phaeosphaeria avenaria f. sp. avenaria (Paa) (ATCC12277, Saa001NY-85); 3

= P. avenaria f. sp. triticea (P. a . f. sp. triticea, Pat3) (S-81-W10); 4-5 = Heterothallic P. a . f. sp. triticea (Pat2) (ATCC26370,

AT CC26377); 6 = Phaeosphaeria sp. from Polish r ye (P-rye) (Sn48-1); 7 = P. nodorum, whe at-biot ype (PN-w) (Sn27-1);

8-9 = P. nodor um, barley-biotype (PN-b) (S-84-2, S-83-2); 10-11 = Homothallic P. a. f.s p. triticea (Pat1) (Sat24-1, 12889);

12 = Phaeosphaeria sp. from dallis grass (P-dg) (S-93-48); B, Pa rtial SSU-rDNA was amplified from the gDNA (a) and the

first strand (1¡Ñ) cDNA (b) with NS1/NS8 primer set. Solid arrows indicated either no introns in gDNA and cDNA or spliced

cDNA. Open arrows indicated the presence of introns in SSU-rDNA of gDNA. Isolates used were: PN-b = S-80-611; Paa =

ATCC12277; Pat2 = ATCC26370; P-dg = S-93-48; P-rye = Sn48-1.

Figure 2. Group I insertions in the small subunit of ribo-

som al DNA (SSU-rDNA) of Phaeosphaeria sp ecie s. T he

numbers below each t riangle corresponds to the intron posi-

tions relative to the SSU-rDNA sequence of Escherichia coli

(accession number J01695). Paa = Phaeosphaeria avenaria

f. sp. avenaria; P-rye = Phaeosphaeria sp. from Polish

rye; P-dg = Phaeosphaeria sp. from dallis grass; Pat2 =

Heterothallic P. avenaria f.sp. triticea.

plant genus names were temporarily used as the 2

nd

and

3

rd

letters in the naming of the introns. Therefore, group

I introns found in P-rye (from rye [Secale cereale L.]),

Pat2 (from foxtail barley [Hordeum jubatum L.]) and P-dg

(from dallis grass [Paspalum dilatatum L.]) are called Pse.

nS943, Pho.nS1533 and Ppa.nS1199, respectively.

Predicted secondary structures of group I

intron

The secondary structures of 4 group I introns found in

the SSU-rDNA in Phaeosphaeria species were composed

of nine base-paired segments, characterized by a conserved

active structure that was formed by the assembly of the

¡¥J¡¦ (including P4-P6) and the ¡¥P¡¦ (including P3, P7 - P9)

142

Botanical Studies, Vol. 50, 2009

structural elements, and other peripheral elements needed

for splicing (Figure 3) (Burke et al., 1987; Cech, 1988;

Michel and Westhof, 1990; Golden et al., 1998; Adams et

al., 2004). Internal guide sequences (IGS) were recognized

which base pair tightly with the 5¡¦ exon to form a P1 helix

before docking into the catalytic core and that permits to

stable tertiary interactions during the course of the self-

splicing (Been and Cech, 1986; Pyle and Cech, 1991)

(Figure 3). Also as expected, a 3¡¦ end exon base ¡¥U¡¦

immediately upstream of the 5¡¦ intron splicing site and a

3¡¦ end intron base ¡¥G¡¦ preceding the 3¡¦ intron splicing site

were located (Michel and Westhof, 1990). However, there

was an exception in Pho.nS1533 intron, which had ¡¥GU¡¦

preceding the 3¡¦ intron-splicing site (Figure 3C).

Based on 4 consensus sequences (P, Q, R and S

elements), Pav.nS943, Pse.nS943 and Pho.nS1533

complied with the expected consensus for groups IA-ID

introns, and Ppa.nS1199 with group IE introns (Table 3)

Figure 3. Predicted secondary structure models of Phaeosphaeria group I introns. Intron representatives of Pse.nS943 (A), Pav.

nS943 (B), Pho.nS1533 (C) and Ppa.nS1199 (D) were shown. The intron sequences were numbered from 5¡¦ end to 3¡¦ end and in

uppercase letters whilst the 5¡¦ and 3¡¦ exons in lowercase letters. The bolded and circled letters were the conserved sequence ele-

ments, P, Q, R and S. The characteristics of helixes were termed from P1 to P10 following the struct ural conventions for Group

I introns (Burke et al., 1987). T he P13 stem formed by base pairing of two remote peripheral elements P2.1 and P9.1 in (D) was

indicated. The recognition and binding of a 5¡¦ end internal guide sequences (IGS) with the 3¡¦ exon sequences in splicing were

boxed. Three shaded letters in (B) were base substitutions occurred in respective isolates, 1919WRS (at nt100, C ¡÷ T), Sa37-2

(at nt128, A ¡÷ G) and ATCC12277 (at nt336, A ¡÷ G).

WANG et al. ¡X Group I intron in rDNA

143

(Cech, 1988; Michel and Westhof, 1990; Suh et al., 1999;

Gibb and Hausner, 2003; Li and Zhang, 2005). Three

introns from cereal Phaeosphaeria pathogens (Pav.nS943,

Pse.nS943 and Pho.nS1533) had typical long extended P5

domains (P5a-P5d) in their predicted secondary structures

(Figure 3A-C). Presence of long extended P5 domains

in these introns might suggest that they were ancestral

type and able to self-splice (Haugen et al., 2004). Like

other group IE introns, there was only a short peripheral

P5 region (without P5a-P5d) in the secondary structure

of the Ppa.nS1199 intron (Li and Zhang, 2005) (Figure

3D). In the secondary structure of the Ppa.nS1199 intron,

formation of a P13 stem by base-pairing of two remote

peripheral elements, P2.1 and P9.1, was reported to be an

important feature, and play a role in the functional folding

of the active structure in subgroup IE intron (Figure 3D)

(Li and Zhang, 2005; Xiao et al., 2005).

Subgrouping group I introns

Based on nucleotide sequences of the secondary

structure components, phylogenetic relationships of

introns from 4 Phaeosphaeria with other 11 known group

I introns were compared. It appeared that Pav.nS943, Pse.

nS943 and Pho.nS1533 introns were closely related to

IC1 subgroup, and Ppa.nS1199 belonged to subgroup IE3

(Figure 4).

Table 3. Alignments of 4 consensus sequence elements in the group I introns of ribosomal DNA in Phaeosphaeria species.

Introns

Species Intron size (bp)

Consensus conserved sequences in the elements

P

Q

R

S

Groups IA - ID

a

-

-

au

a uncnngaAn

ua

c

aAunngnag

g

Guu ga

cA GacUana

ccg..ac

c

AaGauAuAgUC

u

Pav.nS943

Paa

362

aauugcggggaa aauccgcagc guucagagacuaaa aagauauagucc

Pse.nS943

P-rye 363

aauugcggggaa aauccgcagc guucagagacuaaa aagauauagucc

Pho.nS1533

Pat2

460

aauugcggggaa aauccgcagc

guucacagacuaag

aagauauagucg

Group E

b

ua g g

GG cn gG An

Au u a

a c u

AUc ng Gg

g a a

uc ga ca

uc A GCncG

gu ac gu

a g c

AGG AcguGC

c u u

Group E

c

g ua g gg

G cn g An

u au u aa

a c u

AUc ng Gg

g a a

uc ga c ca

uc A G ncG

gu ac u gu

a g g c

AGG Acgu C

c u a u

Ppa.nS1199

P-dg

383 gguacagggaac gauccugugg ucgcaacgcgcgga aagguacgugcu

Consensus conserved sequences were after

a

Cech, 1988,

b

Suh et al., 1999 and

c

Gibb and Hausner, 2003.

Underlined nucleotides are proposed to be base-paired in the secondary structure. Bulged nucleotides within base-paired

segments are found in #7 nucleotide of the ¡¥R¡¦ element. An uppercase letter in consensus conserved sequences designates >90%

conservation of the particular nucleotide; a lowercase letter designates 70-90% conservation. A pair of lowercase letters indicates

that two nucleotides frequently occupy the position and together account for >90% of the sequences; "n" in a position indicates

that no nucleotide is conserved at the level of these criteria. Shaded nucleotides in the group I introns are not identical to consensus

sequences.

Fi gure 4 . Phylogenetic relationships of group I introns

in the small su bu n it r ib oso mal DNA (SSU -rDNA) of

Phaeosphaeria species. Data of aligned secondary structure

components from 4 Phaeosphaeria int rons (see Table 2) and

6 introns re presenting groups IA-IB and 6 of the group IE

aligne d respectively by Michel and Westhof (1990) and Li

and Zhang (2005) were used for analysis. The numbers in

pa rentheses are GenBank acce ssion numbers. Except for 4

underlined introns from Phaeosphaeria species which puta-

tively follows the nomination of Johansen and Haugen¡¦s pro-

posal (2001), int ron names in square brackets are abbreviated

as by Cech (1988). Bootst rap values (with 1000 replications)

of the internal branches larger than 50% are indicated.

144

Botanical Studies, Vol. 50, 2009

DISCUSSION

Group I introns are found in both the SSU and LSU

rRNA genes in numerous parasitic, lichen-forming and

mycorrhizal fungi (De Wachter et al., 1992; Lin et al.,

1992; Liu and Leibowitz, 1993; Mercure et al., 1993;

Egger et al., 1995; Chen et al., 1996, 1998; Neuveglise et

al., 1997; Tan, 1997; Ito and Hirano, 1999; Myllys et al.,

1999; Mavridou et al., 2000; Perotto et al., 2000; Suga et

al., 2000; Gibb and Hausner, 2003; Lickey et al., 2003;

Wang et al., 2003; Cote et al., 2004). Group I introns were

found in the LSU-rDNA of the soil-borne wheat take-all

disease pathogen, Gaeumannomyces graminis (Tan, 1997).

Group I introns were also found in the SSU-rDNA of

numerous Septoria and other anamorphic species related

to the teleomorphic genus Mycosphaerella from banana

and woody and ornamental plants (Feau et al., 2007).

However, the present of group I introns in the rDNA of

M. graminicola (anamorph: Septoria tritici) and Septoria

passerinii, two important leaf blotch pathogens in cereals,

have not been studied.

Allelic heterogeneity of group I introns in rDNA has

been reported in numerous fungi. In some organisms,

group I introns only inserted in partial repeats of ribosomal

DNA repeats tandem located in genome of the same strain.

(Lin et al., 1992; Wetzel et al., 1999; Lickey et al., 2003).

In strain P-rye Sn48-1, ribosomal repeat regions inserted

with intron were amplified by PCR at less frequent than

intron-less regions (Figure 1A, lane 6 and Figure 1B,

P-rye). The presence of the intron was often variable with

strains of a species or among strains of different species.

For example, only some strains of Candida albicans and

Monilinia fructicola are reported to have the same group

I introns in the rDNA (Mercure et al., 1993; Cote et al.,

2004). Also, in the ericoid mycorrhizal fungi, no group

I intron was present in all SSU rDNA repeats in 1 of 11

Oidiodendron maius isolates (Perotto et al., 2000). The

variation in the presence of the introns also found in both

Paa and P-rye (Table 1).

Group I introns are widely distributed in nuclear SSU-

and LSU-rDNA. With 2,179 introns so far reported in

SSU-rDNA, there are 117 intron positions identified in

the 1542 bp-long reference Escherichia coli 16S rDNA

(Accession number J01695) (www.rna.icmb.utexas.edu).

Of which 16.5% and 6.2% introns are inserted at the

nt943 and nt1199 positions, respectively. In this study,

three group I introns from Phaeosphaeria (Pav.nS943,

Pse.nS943, and Ppa.nS1199) were located in these two

common positions (Figure 2). Nevertheless, here we report

a new group I intron-inserted position at nt1533 of E.

coli 16S rDNA, which is identified in Pat2 (Pho.nS1533)

(Figure 2).

It had been showed that nucleotide sequences of

secondary structure components were conserved in the

same subgroups of group I introns which inserted in

either nucleus or organelles and even in distantly relative

organisms (Michel and Westhof, 1990; Suh et al., 1999).

For instance, Pav.nS943, Pse.nS943 and Pho.nS1533

introns were grouped in IC1 with an intron inserted in

the nuclear LSU-rDNA of Tetrahymena thermophila (Tt.

LSU), a ciliated protozoan, rather than other subgroup

such as the IE2 in LSU-rDNA of Candida albicans

(Ca. LSU, X74272), which was more closely related

t o Phaeosphaeria (Figure 4). Furthermore, types of

subgroups seem to be associated with the exons in which

group I introns inserted. In a collective survey of 747 group

I introns from fungal nuclear SSU-rRNA genes, almost

all of them belong to either group IC introns (65.6%) or

group IE (34.3%) (www.rna.icmb.utexas.edu, Cannone

et al., 2002). Four group I introns from Phaeosphaeria

spp. are also grouped into these two subgroups (Figure

4). Group I introns are commonly inserted in highly

conserved regions of the SSU-rRNA genes. It had been

shown that the same subgroup group I introns that occupy

the same position in SSU-rDNA but in distantly related

hosts, tend to share a number of structure features as well

as high levels of primary sequence similarities compared

to introns at different insertion positions, thus allowing to

explore their phylogenetic relationships (Suh et al., 1999;

Nikoh and Fukatsu, 2001). It is suggested that the intron

insertion positions are related to the nature of the intron

subgroups to which they belong. In a comparison with

numerous group I introns found in the SSU-rRNA genes

from several fungi and green algae, the position at nt1199

tended to be a common position for subgroup IE3, and the

position at nt943 for subgroup IC1 (Michel and Westhof,

1990; Takashima and Nakase, 1997). Like the Ppa.nS1199

intron from P-dg, many group I introns inserted at position

nt1199 are reported to have group IE secondary structures

(Gibb and Hausner, 2003; Li and Zhang, 2005; Feau et al.,

2007).

Group I introns were suggested to be either transferred

horizontally to the distinct insertion sites or inherited and

diverged vertically (Shinohara et al., 1996; Tan, 1997;

Mavridou et al., 2000; Gibb and Hausner, 2003, Martin et

al., 2003; Wang et al., 2003). Horizontal transfer events

were suggested to occur to group I introns of SSU-rDNA

in Septoria and other anamorphic species related to the

teleomorphic genus Mycosphaerella (Feau et al., 2007).

Based on the Phylogenetic relationships inferred from the

£]-tubulin (tubA), £]-glucosidase (bgl1), and the second

largest subunit of RNA polymerases II (RPB2) genes, two

sister clades, P-rye-PN-w and Paa-Pat3, were consistently

recovered with well supports (Malkus et al., 2005; Reszka

et al., 2005; Malkus et al., 2006). An additional intron

found in P. eustoma isolate AFTOL-ID 1570 (DQ678011),

a leaf pathogen of reed manna grass (Glyceria maxima

(Hartm.) Holmb.), had 99% nucleotide similarity with

Pav.nS943 and 93% with Pse.nS943. It is likely that the

Phaeosphaeria intron inserted at nt943 position was

vertically transferred from the common ancestor of P.

eustoma, Paa, and P-rye, rather than gained from 2 or more

horizontal transfer events. During the speciation, intron

loss could also have occurred in other Phaeosphaeria

species nested within the two sister clades such as the

P-rye-PN-w and the Paa-Pat3.

WANG et al. ¡X Group I intron in rDNA

145

lITeRATURe CITeD

Adams, P.L., M.R. S tahley, A.B. Kos ek, J . Wang, and S.A.

Strobel. 2004. Crystal structure of a self-splicing group I

intron with both exons. Nature 430: 45-50.

Beagley, C.T., R. Okimoto, and D.R. Wolstenholme. 1998. The

mitochondrial genome of the sea anemone Metridium senile

(Cnidaria): introns, a paucity of tRNA genes, and a near-

standard genetic code. Genetics 148: 1091-1108.

Been, M.D. and T.R. Cech. 1986. One binding site determines

sequence specificity of Tetrahymena pre-rRNA self-splicing,

trans-splicing and RNA enzyme activity. Cell 47: 207-216.

Belfort, M. and P.S. Perlm an. 1995. Mechanism s of intron

mobility. J. Biol. Chem. 270: 30237-30240.

Burke, J.M., M. Belfort, T.R. Cech, R.W. Davies, R.J. Schweyen,

D.A. Shub, J.W. Szostak, and H.F. Tabak. 1987. Structural

conventions for group I introns. Nucleic Acids Res. 15:

7217-7221.

Cannone, J.J., S. Subramanian, M.N. Schnare, J.R. Collett, L.M.

D¡¦S ouza, Y. Du, B. Feng, N. Lin, L.V. Madabus i, K.M.

Muller, N. Pande, Z. Shang, N. Yu, and R.R. Gutell. 2002.

The comparative RNA web (CRW) site: an online database

of com parative sequence and structure information for

ribosomal, intron, and other RNAs. BMC Bioinformatics 3:

2.

Cech, T.R. 1988. Conserved sequences and structures of group I

introns: building an active site for RNA catalysis-a review.

Gene 73: 259-271.

Chen, W., L.E. Gray, and C.R. Grau. 1998. Characterization

of a group I intron in the nuclear rDNA differentiating

Phialophora gregata f.sp. adzukicola from P. gregata f.sp.

sojae. Mycoscience 39: 279-283.

Chen, W., C.A. Shearer, and J.L. Crane. 1996. Identification

of a group I intron in the nuclear small subunit rDNA of

Pseudohalonectria lignicola. Curr. Microbiol. 33: 84-88.

Cote, M.J., M. Prud¡¦homme, A.J. Meldrum, and M.C. Tardif.

2004. Variation in sequence and occurrence of SSU rDNA

group introns in Monilinia fructicola isolates. Mycologia

96: 240-248.

De Rijk, P., J. Wuyts, and R. De Wachter. 2003. RnaViz 2: an

im proved represe nt ation of RNA s econdary structure.

Bioinformatics 19: 299-300.

De Wachter, R., J.M. Neefs, A. Goris, and Y. Van de Peer. 1992.

The gene coding for small ribosomal subunit RNA in the

basidiomycete Ustilago maydis contains a group I intron.

Nucleic Acids Res. 20: 1251-1257.

Egger, K.N., G. Os mond, and J.L. Goodier. 1995. Sequence

and putative s econdary structure of group I introns in

the nuclear-encoded ribosomal RNA genes of the fungus

Hymenoscyphus ericae. Biochimica et Biophysica Acta

1261: 275-278.

Feau, N., R.C. Hamelin, and L. Bernier. 2007. Variability of

nuclear SSU-rDNA group introns within Septoria species:

incongruence with host sequence phylogenies. J. Mol. Evol.

64: 489-499.

Fukami, H., C.A. Chen, C.Y. Chiou, and N. Knowlton.

2 0 07 . No ve l g ro up I i n t ro ns e nc o di n g a p ut a t iv e

homing endonuclease in the mitochondrial cox1 gene of

scleractinian corals. J. Mol. Evol. 64: 591-600.

Gibb, E.A. and G. Hausner. 2003. A group I intron-like

sequence in the nuclear small ribosomal subunit gene of the

ophiostomatoid fungus Gondwanamyces proteae. Mycol.

Res. 107: 1442-1450.

Goddard, M.R. a nd A. Burt. 1999. Re current invasion and

extinction of a selfish gene. Proc. Natl. Acad. Sci. USA 96:

13880-13885.

Golden, B.L., A.R. Gooding, E.R. Podell, and T.R. Cech. 1998.

A preorganized active site in the crystal structure of the

Tetrahymena ribozyme. Science 282: 259-264.

Gutell , R.R. 1993. Col lect ion of sm all s ubunit (16 S- and

16S-like) ribosomal RNA structures. Nucleic Acids Res. 21:

3051-3054.

Haugen, P., H.J. Runge, and D. Bhattacharya. 2004. Long-term

evolution of the S788 fungal nuclear small subunit rRNA

group I introns. RNA 10: 1084-1096.

Haugen, P., D.M. Simon, and D. Bhattacharya. 2005. The natural

history of group I introns. Trends Genet. 21: 111-119.

Holst-Jensen, A., M. Vaage, T. S chumacher, and S. Johansen.

1999. Structural characteris tics and possible horizontal

transfer of group I introns between closely related plant

pathogenic fungi. Mol. Biol. Evol. 16: 114-126.

Ito, Y. and T. Hirano. 1999. A group I intron in the 18S ribosomal

DNA from the parasitic fungus Isaria japonica. J. Mol.

Evol. 48: 337-340.

Johansen, S. and P. Haugen. 2001. A new nomenclature of group

I introns in ribosomal DNA. RNA 7: 935-936.

Lambowitz, A.M. and M. Belfort. 1993. Introns as mobile

genetic elements. Annu. Rev. Biochem. 62: 587-622.

Li, Z. and Y. Zhang. 2005. Predicting the secondary structures

a nd tert iary in terac tions of 211 group I introns in IE

subgroup. Nucleic Acids Res. 33: 2118-2128.

Lickey, E.B., K.W. Hughes, and R.H. Petersen. 2003. Variability

and phylogenetic incongruence of an SS U nrDNA group

I int ron in Artomyces, Auriscalpium, a nd Lentinellus

(Auriscalpiaceae: Homobasidiomycetes). Mol. Biol. Evol.

20: 1909-1916.

Li n, H., M.T. Ni u, T. Yogana tha n, and G.A. Buck. 1992.

C ha ra ct e riz a ti on of t he rR NA-e nc od in g ge ne s a nd

t r an s c ri p ts , a n d a gr ou p- 1 s e lf -s p l i ci n g in t ro n i n

Pneumocystis carinii. Gene 119: 163-173.

Liu, Y. and M.J. Leibowitz. 1993. Variation and in vitro splicing

of group I introns in rRNA genes of Pneumocystic aarinii.

Nucleic Acids Res. 21: 2415-2421.

Lonergan, K.M. and M.W. Gray. 1994. The ribosomal RNA

gene region in Acanthamoeba castellanii mitochondrial

DNA. A case of evolutionary transfer of introns between

mitochondria and plastids. J. Mol. Biol. 239: 476-499.

Martin, M.P., D.H. Coucheron, and S. Johansen. 2003. Structural

features and evolutionary considerations of group IB introns

146

Botanical Studies, Vol. 50, 2009

in S SU rDNA of the lichen fungus Teloschistes. Fungal

Genet. Biol. 40: 252-260.

Malkus , A., P.F.L. Chang, S.M. Zuzga, K.R. Chung, J. Shao,

B.M. Cunfer, E. Arse niuk, a nd P.P. Ueng. 2006. RNA

polymerase II gene (RPB2) encoding the second largest

protein subunit in Phaeosphaeria nodorum and P. avenaria.

Mycol. Res. 110: 1152-1164.

Malkus, A., E. Reszka, C.J. Chang, E. Arseniuk, P.F.L. Chang,

and P.P. Ueng. 2005. Sequence diversity of £]-tubulin (tubA)

gene in Phaeosphaeria nodorum and P. avenaria. F EMS

Microbiol. Lett. 249: 49-56.

Mathews, D.H., J. Sabina, M. Zuker, and D.H. Turner. 1999.

E xp an ded s eq uen ce de pe nde nc e o f th erm o dyna m ic

p ara m et er s im pro ves p red ic ti on o f RNA s ec ond ary

structure. J. Mol. Biol. 288: 911-940.

Mathews, D.H., M.D. Disney, J.L. Childs, S.J. Schroeder, M.

Z uker, and D.H. Turner. 2004. Incorporating che mical

m odi fica tion cons traints into a dynamic programming

algorithm for prediction of RNA secondary structure. Proc.

Natl. Acad. Sci. USA 101: 7287-7292.

Mavridou, A., J. Cannone, and M.A. Typas. 2000. Identification

of group-I introns at three different positions within the 28S

rDNA gene of the entomopathogenic fungus Metarhizium

anisopliae var. anisopliae. Fungal Genet. Biol. 31: 79-90.

Mercure, S., S. Montplaisir, and G. Lemay. 1993. Correlation

b etwee n the pres ence of a s elf-s pli cin g intron i n the

25S rDNA of C. albicans and strains sus ceptibility to

5-fluorocytosine. Nucleic Acids Res. 21: 6020-6027.

Michel , F. and E. West hof. 1990. Modelli ng of t he three-

dimensional architecture of group I catalytic introns based

on c omparative seque nc e anal ys is . J. Mol. Biol. 216:

585-610.

Myllys, L., M. Kallersjo, and A. Tehler. 1999. Variable sizes

of introns in the SSU rDNA in three species of Roccella

(Arthoniales, Euascomycetes). Curr. Genet. 36: 79-85.

Ne uve glise , C., Y. Brygoo, and G. Riba. 1997. 28S rDNA

group-I introns: a powerful tool for identifying strains of

Beauveria brongniartii. Mol. Ecol. 6: 373-381.

Nikoh, N., and T. Fukatsu. 2001. Evolutionary dynamics of

multiple group I introns in nuclear ribosomal RNA genes

of endoparasitic fungi of the genus Cordyceps. Mol. Biol.

Evol. 18: 1631-1642.

Nishida, K., S. Suzuki, Y. Kimura, N. Nomura, M. Fujie, and T.

Yamada. 1998. Group I introns found in Chlorella viruses:

biological implications. Virology 242: 319-326.

Perotto, S., P. Nepote -F us , L . S aletta, C. Bandi, and J.P.W.

Young. 2000. A diverse population of introns in the nuclear

ribosomal genes of ericoid mycorrhizal fungi includes

elements with sequence similarity to endonuclease-coding

genes. Mol. Biol. Evol. 17: 44-59.

Pyle, A.M. and T.R. Cech. 1991. Ribozyme recognition of RNA

by tertiary interactions with specific ribose 2¡¦-OH groups.

Nature 350: 628-631.

Reszka, E., E. Arseniuk, A. Malkus, K.R. Chung, N.R.

O¡¦Neill, Q.J. Song, and P.P. Ueng. 2006. A new biotype

of Phaeosphaeria s p. of unc er ta in affi ni ty ca us in g

Stagonospora leaf blotch disease in cereals in Poland. Plant

Dis. 90: 113.

Reszka, E., K.R. Chung, A. Tekauz, A. Malkus, E. Arseniuk,

J.M. Krupinsky, H. Tsang, and P.P. Ueng. 2005. Presence

of £]-glucos idase (bgl1) gene in Phaeosphaeria nodorum

and Phaeosphaeria avenaria f.sp. triticea. Can. J. Bot. 83:

1001-1014.

Riipinen, K.A. and T Alatossava. 2004. Two self-splicing group

I introns interrupt two late transcribed genes of prolate-

headed L actobacillus delbrueckii phage JCL1032. Arch.

Virol. 149: 2013-2024.

Roman, J. and S. A. Woodson. 1998. Integration of the

Tetrahymena Group I intron into bacterial rRNA by reverse

splicing in vivo. Proc. Natl. Acad. Sci. USA 95: 2134-2139.

Saldanha, R., G. Mohr, M. Belfort, and A.M. Lambowitz. 1993.

Group I and group II introns. The FASEB J. 7: 15-24.

Sandegren, L. and B.M. Sjoberg. 2004. Distribution, sequence

homology, and homing of group I introns among T-even-

like bacteriophages. J. Biol. Chem. 279: 22218-22227.

Shinohara, M.L., K.F. LoBuglio, and S.O. Rogers. 1996. Group-I

intron family in the nuclear ribosomal RNA small subunit

genes of Cenococcum geophilum isolates. Current Genetics

29: 377-387.

Simon, D., J. Moline, G. Helms, T. Friedl, and D. Bhattacharya.

2005. Divergent histories of rDNA group I introns in the

lichen family Physciaceae. J. Mol. Evol. 60: 434-446.

Stankovic, S., B. Soldo, T. Beric-Bjedov, J. Knezevic-Vukcevic,

D. Simic, and V. Lazarevic . 2007. S ubs pe cies-specific

distribution of intervening sequences in the Bacillus subtilis

propha ge ribonucleotide re ductas e genes . Sys t. Appl.

Microbiol. 30: 8-15.

Suga, H., K. Oyabu, M. Ito, K. Kageyama, and M. Hyakumachi.

2000. Dete ction of intron-l ike se quences in the s mall

subunit rDNA 3¡¦ region of Fusarium solani. Mycol. Res.

104: 782-787.

Suh, S-O., K.G. Jones, and M. Blackwell. 1999. A group I intron

in nucl ear small subunit rRNA gene of Cr yptendoxy la

hypophloia, an ascomycetous fungus: Evidence for a new

major class of group I introns. J. Mol. Evol. 48: 493-500.

Takashima, M. and T. Nakase. 1997. A phylogenetic analysis

of three group I introns found in the nuclear small subunit

ri bos o ma l RNA g en e o f t he ba l li s to co ni di oge no us

anamorphic yeast-like fungus Tilletiops is flava. Genes

Genet. Syst. 72: 205-214.

Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4:

Mole cul ar Ev olut iona ry Gene tic s Analy si s (ME GA)

software version 4.0. Mol. Biol. Evol. 24: 1596-1599.

Tan, M.K. 1997. Origin and inheritance of group I introns in 26S

rRNA genes of Gaeumannomyces graminis. J. Mol. Evol.

44: 637-645.

Turmel, M., J. Boulanger, M.N. Schnare, M.W. Gray, and C.

Lem ieux. 1991. Six group I introns a nd three i nt ernal

tra ns cri bed s pac ers i n the ch loro pla st la rge s ub unit

ribosomal RNA gene of the green alga Chlamydomonas

WANG et al. ¡X Group I intron in rDNA

147

eugametos. J. Mol. Biol. 218: 293-311.

Ueng, P.P., G.C. Bergstrom, R.M. Slay, E.A. Geiger, G.

S haner, and A.L . Scharen. 1992. Res triction fra gm ent

length polymorphisms in the wheat glume blotch fungus,

Phaeosphaeria nodorum. Phytopathology 82: 1302-1305.

Ueng, P.P., E . Re szka, K.R. Chung, E . Ars eniuk, and J .M.

Krupinsky. 2003. Comparison of glyceraldehyde-3-

phosphate dehydrogenase genes in Phaeosphaeria nodorum

and P. avenaria species. Plant Pathol. Bull. 12: 255-268.

Wang, C., Z. Li, M.A. Typas, and T.M. Butt. 2003. Nuclear large

subunit rDNA group I intron distribution in a population

of Beauveria bassiana strains: phylogenetic implications.

Mycol. Res. 107: 1189-1200.

Wa ng, C.L., A. Mal kus, S .M. Zuzga , P.F.L. Chan g, B .M.

Cunfer, E. Ars eniuk, and P.P. Ueng. 2007. Diversity of

the trifunctional histidine biosynthesis gene (his) in cereal

Phaeosphaeria species. Genome 50: 595-609.

Wetzel, H.C., S.H. Hulbert, and N.A. Tisserat. 1999. Molecular

evidence for the presence of Ophiosphaerella narmari n.

comb., a cause of spring dead spot of Bermuda grass, in

North America. Mycol. Res. 103: 981-989.

Xiao, M., T. Li, X. Yuan, Y. Shang, F. Wang, S. Chen, and Y.

Zhang. 2005. A peripheral element assembles the compact

core structure es sential for group I intron s elf-splicing.

Nucleic Acids Res. 33: 4602-4611.