Botanical Studies (2009) 50: 159-170.

6

Equal contribution to this work.

*

Corresponding author: E-mail: boyhlin@gate.sinica.edu.

tw, Phone: 886-2-27871172, Fax: 886-2-27827954 (Yaw-

Huei Lin); E-mail: hjchen@faculty.nsysu.edu.tw, Phone:

886-7-5252000 ext. 3630, Fax: 886-7-5253630 (Hsien-Jung

Chen).

INTRODUCTION

Sweet potato (Ipomoea batatas (L.)) is a gamopetalous

dicot and belongs to the order of Polemoniales and the

family Convolvulaceae (Sihachakr et al., 1997). It is an

important food crop in the tropics, and has been imported

into Taiwan since the 17

th

century. Storage roots and leaves

are the edible portions, and its nutritive constituents are

mainly starch, lipid and protein. It also contains plenty of

vitamin B complex, vitamin C, £]-carotenoids, multiple

minerals and high calcium (Yang et al., 1975; Hattori et

al., 1985). Several medicative effects of sweet potato have

been reported previously, including accelerated excretion

Molecular cloning and expression of a sweet potato

cysteine protease SPCP1 from senescent leaves

Hsien-Jung CHEN

1,

*, Guan-Jhong HUANG

2,6

, Wei-Shan CHEN

3,6

, Cheng-Ting SU

3

, Wen-Chi

HOU

4

, and Yaw-Huei LIN

5,

*

1

Department of Biological Sciences, National Sun Yat-sen University, 804 Kaohsiung, Taiwan

2

Graduate Institute of Chinese Pharmaceutical Sciences, China Medical University, 404 Taichung, Taiwan

3

Graduate Institute of Biotechnology, Chinese Culture University, 111 Taipei, Taiwan

4

Graduate Institute of Pharmacognosy Science, Taipei Medical University, 110 Taipei, Taiwan

5

Institute of Plant and Microbial Biology, Academia Sinica, Nankang, 115 Taipei, Taiwan

(Received August 18, 2008; Accepted November 19, 2008)

ABSTRACT.

In this report a full-length cDNA, SPCP1, was isolated from senescent leaves of sweet potato

(Ipomoea batatas (L.) Lam). SPCP1 contained 1020 nucleotides (339 amino acids) in the open reading frame,

and exhibited high amino acid sequence homologies (ca. 58% to 74%) with papain-like cysteine proteases

of Alnus glutinosa, Arabidopsis thaliana, Astragalus sinicus, Brassica napus, Daucus carota, Gossypium

hirsutum, Hordeum vulgare, Iris hollandica, Medicago truncatula, Nicotiana tabacum, Oryza sativa, Ricinus

communis, Trifolium repens. Semi-quantitative RT-PCR and Western blot hybridization showed that SPCP1

gene expression was enhanced significantly in natural senescent leaves and in dark-, ethephon-, and ABA-

induced senescent leaves, whereas, was almost not detected in mature green leaves, stems, and roots.

Initiation of chlorophyll degradation is earlier than the SPCP1 gene expression during leaf senescence. SPCP1

expression was also induced in sweet potato suspension cells treated with 1 mM ethephon. Evan blue staining

showed that suspension cells were not significantly affected by ethephon treatment up to 2 mM, however, most

of the cells died when treated with 10 mM ethephon. In conclusion, sweet potato SPCP1 is likely a functional,

senescence-associated gene and its expression levels were significantly enhanced at mRNA and protein levels

in natural and induced senescent leaves and suspension cells. The physiological role and function of SPCP1

were likely not in association with initiation of chlorophyll degradation and cell death during senescence.

Keywords: Cysteine protease; Ethephon; Leaf senescence; SPCP1; Sweet potato.

of toxins and carcinogens, trypsin inhibitor (Hou et al.,

2001) and antioxidant activity (Huang et al., 2007a and

2007b), inhibition of angiotensin converting enzyme

activity (Hou et al., 2003; Huang et al., 2006), reduction of

hypertension in diabetic mice, and growth inhibition and

induction of apoptosis in NB4 promyelocytic leukemia

cells (Huang et al., 2007c).

Leaf is the main place of photosynthesis and acts as

a source of carbohydrate for sink nutrients in plants. Its

longevity and senescence thus affect the photosynthesis

efficiency and crop yield. Leaf senescence is influenced

by endogenous and exogenous factors, including plant

growth regulators, starvation, wound, and environmentsl

stresses (Yoshida, 2003; Lim et al., 2007). Leaf senescence

is the final stage of development and has been considered

as a type of programmed cell death (Lim et al., 2007).

During senescence, macromolecules are not only simply

degraded, but also recycled. The released small molecules

can be translocated from the senescent cells to young

leaves, developing seeds, or storage tissues (Buchanan-

MOleCUlAR BIOlOgy

160

Botanical Studies, Vol. 50, 2009

Wollaston, 1997; Quirino et al., 2000). Leaf cells undergo

highly coordinated changes in structure, metabolism,

and gene expression during senescence in a defined

order. Breakdown of chloroplast is the earliest and most

significant change in cell structure (Makino and Osmond,

1991). The carbon assimilation is metabolically replaced

by catabolism of chlorophyll and macromolecules such as

proteins, membrane lipids, and RNA (Lim et al., 2007).

During senescence, breakdown of leaf proteins by

proteases provides a large cellular nitrogen pool for

recycling (Makino and Osmond, 1991). In plants, it is

assumed that vacuole is the site involved in bulk protein

degradation by virtue of its resident proteases. Different

types of vacuoles have been reported in plants, including

storage vacuole, lytic central vacuole (Vierstra, 1996;

Marty, 1999), and small senescence-associated vacuoles

(Otegui et al., 2005). Protein storage vacuoles are often

found in seed tissues and accumulate storage proteins that

are remobilized and utilized as the main nutrient resource

for germination (Senyuk et al., 1998; Schlereth et al.,

2001). Most cells in vegetative tissues have a large lytic

central vacuole and many small senescence-associated

vacuoles, which contain a wide range of proteases in an

acidic environment (Otegui et al., 2005). Substrate proteins

must be transported and sequestered into this vacuole for

degradation.

Recently, a group of papain-like cysteine proteases

have been isolated from various senescent tissues of

different species. In Arabidopsis and Brassica napus,

the orthologous genes, SAG12 and BnSAG12, were

demonstrated for their conservation across species from

gene structural comparisons and expression/regulation

studies (Noh and Amasino, 1999). In the nitrogen-fixing

symbiosis interaction of Alnus glutinosa and actiomycete

Frankia, a nodule-specific papain-like cysteine protease

AgNOD-CP1 with unknown function was identified and

isolated (Goetting-Minesky and Mullin, 1994). Gene

expression of the nodule-specific papain-like cysteine

proteases, such as AsNOD32 of Chinese milk vetch

(Astragalus sinicus) (Naito et al., 2000) and Tr-cp of white

clover (Trifolium repens) (Asp et al., 2006) were detected

in the senescing zone and correlated with the onset of

nodule senescence. In Arabidopsis, papain-like cysteine

protease SAG12 was mainly localized in senescence-

associated vacuoles (SAVs) of mesophyll and guard

cells of senescing leaves, and was not required either for

SAV formation or for progression of visual symptoms of

senescence (Otegui et al., 2005). SAG12 was expressed

in sugar-induced and nitrogen deprivation-induced

senescence (Gombert et al., 2006; Pourtau et al., 2006),

and correlated at the whole plant level with the sink/source

transition for nitrogen during both developmental and

nutrient sress-induced leaf senescence (Gombert et al.,

2006). In castor bean (Ricinus communis L.), a papain-

like cysteine protease with a C-terminal KDEL was

immunolocalized specifically in ricinosome, which was

organelles co-purified with glyoxysomes from germinating

Ricinus endosperm, a senescing tissue (Schmid et al.,

1998). The papain-like cysteine endoprotease has the

capacity to process the glyoxysomal malate dehydrogenase

precursor protein into the mature subunit in vitro (Gietl et

al., 1997). In tobacco, the senescence-associated vacuoles

contain soluble chloroplast stromal proteins, including

Rubisco and glutamine synthase, but lack the thylakoid

proteins, such as D1 protein, LHCII of the PSII reaction

center and PSII antenna. The Rubisco levels decrease

steadily in SAVs incubated at 30¢XC, and was completely

abolished by addition of protease inhibitors (Martinez et

al., 2008). These results indicate that SAVs are involved

in the degradation of the soluble photosynthetic proteins

of the chloroplast stroma during senescence of leaves.

Therefore, a possible role for these papain-like cysteine

proteases in association with the clevage and maturation of

proproteinases that are in turn involved in macromolecule

degradation and re-mobilization during leaf senescence

was suggested.

We have previously isolated several senescence-

associated cysteine proteases from sweet potato senescent

leaves in our laboratory (Chen et al., 2004; 2006; 2008).

We report here the cloning and characterization of another

cysteine protease, SPCP1, which exhibited high amino

acid sequence identities with plant vacuolar papain-like

cysteine proteases, including Alnus glutinosa AgNOD-

CP1, Astragalus sinicus AsNOD32, Trifolium repens

Tr-cp, Arabidopsis thaliana and Brassica napus SAG12.

MATeRIAlS AND MeTHODS

Plant materials

The storage roots of sweet potato (Ipomoea batatas (L.)

Lam) were grown in a growth chamber, and plantlets from

the storage roots were used as materials. Mature green

leaves near the top of stems were detached for experiments

of induced senescence by different treatment such as

dark, ethephon, and ABA. Leaves with differential level

of senescence were also used for experiments of tissue-

specific expression.

PCR-based subtractive hybridization and RACe

PCR

Molecular cloning of senescence-associated genes

basically followed the previous report of Chen et al.

(2000). Total RNAs were isolated individually from the

mature green leaves and senescing leaves of sweet potato

basically according to the method of Sambrook et al.

(1989). The mRNAs were purified with a purification kit

(Promega) and used for the differentially-expressed first

strand cDNA synthesis with a PCR-based subtractive

hybridization kit (Clontech) following the protocols

supplied by the manufacturer. The double-strand cDNAs

of senescing leaves were subtracted by that of mature

green leaves, then ligated to pGEM-T vector for E. coli

DH5£\ competent cell transformation. Recombinant

plasmids were isolated for DNA sequencing using an ABI

PRIZM 337 DNA Sequencer. Nucleotide sequence data

CHEN et al. ¡X Sweet potato cysteine protease SPCP1

161

were analyzed using the Genetics Computer Group (GCG)

programs. The RACE PCR method with the Marathon

cDNA amplification kit (Clontech) was used to isolate the

5¡¦ and 3¡¦ ends of the interested cDNAs according to the

protocols provided by the manufacturer.

Southern blot hybridization

Young (not expanded) leaves of sweet potato were

harvested and ground in liquid N

2

. The powder was

transferred to a centrifuge tube, mixed gently and

thoroughly with cetyltrimethylammonium bromide

(CTAB) buffer (2% CTAB, 1.4 mM NaCl, 20 mM ethyle

nediaminetetraacetate (EDTA), 0.2% £]-mercaptoethanol,

and 100 mM Tris-HCl pH 8.0) in a 20:1 (v:w) ratio, and

kept at 60¢XC in a water bath for genomic DNA extraction

according to the method of Chen et al. (2000). The total

nucleic acid after precipitation with an equal volume of

isopropanol was re-dissolved in sterile water, digested

with restriction enzymes of EcoRI, HindIII or XbaI and

separated on a 0.8% agarose gel. After electrophoresis, the

DNA was transferred onto a Hybond-N

+

nylon membrane

(Amersham) following the protocol of Molecular Cloning

(Sambrook et al., 1989) for Southern blot hybridization.

Measurement of pigments

For quantitative analysis of pigment contents, the

mature green leaves (S0) and senescing leaves (S1 and S2)

of sweet potato were collected separately and extracted

with 80% acetone (pH 7.8) buffered with 2.5 mM sodium

phosphate according to the method of Chen et al. (2000).

The absorbance of extracts was measured at wavelengths

of 663.8 nm, 646.8 nm and 470 nm, respectively.

Quantitative values of pigments for aqueous 80% acetone

extracts were calculated from the absorbance data

according to the report of Lichtenthaler (1987). For dark-

induced senescence, detached mature green leaves were

placed on a wet paper towel containing 3 mM 2-(N-mor

pholino)ethanesulphonic acid (MES) buffer pH 7.0, then

kept at room temperature in the dark for 0, 3, 6, 9 and 12

days. For 1 mM ethephon or 100 £gM ABA treatments, the

detached mature green leaves were also placed on a wet

paper towel containing 3 mM MES (pH 7.0) plus different

plant growth regulator, then kept in the dark for 0, 1, 2

and 3 (for ethephon) or 5 (for ABA) days. Leaves were

individually collected for quantitative analysis of pigment

contents and also for semi-quantitative RT-PCR.

Semi-quantitative RT-PCR

Total RNA was isolated from (a) different tissues

including roots, stems, mature green leaves and senescing

leaves, and (b) dark-treated, 1 mM ethephon-treated, or

100 £gM ABA-treated mature green leaves of sweet potato.

The primer pairs (Y136-5¡¦: CACTTTACGGTTGTAAA

CATTTTACA and Y136-3¡¦: GAGATAATACACACCA

ATTAATGGAT) were used to amplify the full-length

SPCP1 cDNAs for semi-quantitative RT-PCR analysis

according to the method of Jonson et al. (2000). The full-

length SPCP1 cDNA was also labelled with digoxigenin-

11-dUTP nucleotides as the probe for semi-quantitative

RT-PCR product detection using Southern blot

hybridization and CSPD substrate (Boehringer Mannheim)

as described previously.

Production of polyclonal antibody against

SPCP1

The full-length SPCP1 cDNA was used as templates to

amplify the PCR products encoding the putative mature

SPCP1 protein with primers (Y136-5¡¦M: GGTATTGA

GGGTCGCGTTCCTACTACCGTGGACTGG and Y136-

3¡¦M: AGAGGAGAGTTA GAGCCCCAAGCAGAGGG

ATATGAT). The amplified PCR products were purified

first and then cloned directly into PET32Xa/LIC vector

(Novagen) according to the protocols provided by the

supplier. After induction with 1 mM IPTG, the expressed

fusion proteins were extracted from cells with 8 M urea,

and purified with His-tag affinity column according

to the protocols from Novagen. The purified fusion

protein was digested with protease Xa factor to release

the expressed SPCP1 mature protein for N-terminal

amino acid sequencing and as an antigen for polyclonal

antibody production in rabbits. For N-terminal amino acid

sequence determination, the purified fusion proteins were

first digested with Xa factor, and then mixed with SDS

sample extraction buffer and boiled in a 100¢XC water bath

for 5 min. The samples were subjected to protein SDS-

PAGE in 12.5% gels, then, transferred onto Millipore

PVDF membranes. The band with molecular weight

corresponding to the expressed SPCP1 mature protein was

cut from PVDF membrane and used for N-terminal amino

acid determination. For polyclonal antibody production,

the purified fusion protein was first dgested with Xa factor,

and then performed a 12.5% SDS-PAGE. The band with

molecular weight corresponding to the expressed SPCP1

mature protein was cut from the 12.5% polyacylamide gel,

then, mixed with appropriate amount of pH 7.5 phosphate

buffer saline (PBS) containing 0.1% SDS. The eluted

proteins in PBS containing 0.1% SDS were precipitated

with acetone containing 10% trichloroacetic acid (TCA) at

-20¢XC for 2 h. After centrifugation at 13,000 xg for 20 min,

the pellet was washed with acetone twice, then, dried at

room temperature. The acetone powder was re-dissolved

in a small amount of PBS buffer containing 0.1% SDS and

used as antigens for subcutaneous injections (Taiwan Bio-

Pharm Inc.).

Western blot hybridization and activity staining

Polyclonal antibody obtained from rabbit antiserum

was utilized for Western blot hybridization to study the

gene expression of SPCP1 in different tissues, leaves with

various levels of senescence, and with dark or ethephon

treatments as described previously. For enzymatic

activity analysis, basically it follows the method reported

by Lee and Lin (1995). The crude protein extract from

S2 leaves was analyzed for protease activity in the

162

Botanical Studies, Vol. 50, 2009

presence or absence of inhibitor L-3-carboxy-2,3-trans-

epoxypropionyl-leucyl-amino (4-guanidino) butane

(E-64) in gelatin-containing polyacrylamide gel. About

0.5 g S2 senescent leaves were ground with mortar and

pestle in liquid N

2

and the powder was extracted with

extraction buffer containing 10 mM Tris-HCl and 1 mM

EDTA pH 6.8. The mixture was centrifuged at 13,000 xg,

4¢XC for 10 min, then, the supernatant was transferred to

a new centrifuge tube. The crude extract was mixed with

equal volume of 2x SDS buffer (4.6%) and stayed at 4¢XC

for overnight. After incubation, sample buffer without

SDS was added into the crude extract in the presence or

absence of E-64 inhibitor, and perform electrophoresis on

a 12.5% SDS-PAGE containing 0.4 to 1% gelatin. After

electrophoresis, the gel was washed twice with isopropanol

to replace SDS from gels, then, incubated in 100 mM Tris-

HCl buffer containing £]-mercaptoethanol with pH 6.0

at 37¢XC for 30 min to 1 h. After incubation, the gel was

stained with Coomassie Blue R250 staining dye to detect

the protease activity bands on gels.

Induction of SPCP1 in sweet potato cell

suspension culture

Fully-expanded mature green leaves of sweet potato

were collected and disinfected in 2% sodium hypochlorite

for about 10 min, then washed with sterile water for three

times. After disinfection, the leaves were cut into strips

and incubated on solid MS medium supplemented with

3% sucrose, 1 ppm 2,4-D, and B5 vitamins for callus

induction in a day/night cycle with 28¢XC day and 23¢XC

night, 16 h day and 8 h night. The induced calli were

routinely maintained and subcultured monthly on the

same medium. For cell suspension culture establishment,

calli about one month after subculture were transferred

into the same liquid medium and shaked on an orbital

shaker with 100 rpm. The cell suspension culture were

routinely maintained once a week in a 1:2 (v:v) ratio of

cell suspension to fresh medium at room temperature in

the dark. For growth curve determination, total about 30

mL of diluted cell suspension as described above was

filtered with Whatmann No. 4 filter paper at the intervals

of day 0, 3, 6, 9, 12, 15 and 18, respectively, and the cells

retained on the filter membrane were collected for fresh

weight determination. Ethephon, an ethylene-releasing

compound, can be catalyzed to release ethylene, HCl, and

H

3

PO

4

in a 1:1:1 ratio after uptake into cells. Therefore,

treatment of 1 mM HCl plus 1 mM H

3

PO

4

was used as

additional control. For ethephon treatment, about 10 mL of

diluted cell suspension was treated with 1 mM ethephon

or 1 mM HCL plus 1 mM phosphate, and harvested at

intervals (a) of day 0, 3 and 6, respectively, for fresh

weight measurement, and (b) of day 1, and 3, respectively,

for the induction of SPCP1 gene expression. The effect

of ethephon on cell viability was also assayed with evan

blue staining dye. Suspension cells were treated with 0,

1, 2, 10 mM ethephon, respectively, for three days. After

treatment, the cells were collected and stained with 0.25%

evan blue staining dye in PBS buffer at 25¢XC for 30 min,

then washed with PBS for 10 min before microscopic

observation.

ReSUlTS

Nucleotide and amino acid sequences of SPCP1

With PCR-based subtractive hybridization and RACE

PCR techniques, a full-length cDNA, SPCP1 (GenBank

accession no. AF242372), was cloned from senescent

leaves. There were 1020 nucleotides (339 amino

acids) in its open reading frame (Figure 1). GCG/fasta

comparison showed that SPCP1 exhibited high amino

acid sequence homologies (58% to 74%) with papain-

like cysteine proteases of Alnus glutinosa (AAA50755;

71%), Arabidopsis thaliana (AAK43946 and AAC49135;

58%), Astragalus sinicus (BAB13759; 71%), Brassica

napus (AAD53011; 59%), Daucus carota (BAD29955;

73%), Gossypium hirsutum (AAT34987; 74%), Hordeum

vulgare (CAB09697; 59%), Iris hollandica (AAR92154;

70%), Medicago truncatula (AAQ63885; 72%), Nicotiana

tabacum (AAW78660; 60%), Oryza sativa (CAD40112;

67%), Ricinus communis (AAC62396; 60%), Trifolium

repens (AAP32196; 73%).

From the alignment of SPCP1 putative catalytic domain

with other plant cysteine proteases, a conservation of the

catalytic residues within the domains was observed. The

F igure 1. Nucleotide and a mi no acid se que nces of sweet

potato putative cysteine protease S PC P1 isolated from senes-

cent leaves. ATG (underlined) and TGA (underl ined) re p-

resent the initiation and stop codons, respectively. The Gln

(Q), Cys (C), His (H) and Asn (N) printed in white on black

represe nt the conserved catalytic amino acid residues. T he

arrow (¡ô) represents the possible cleavage site of N-terminus

of the SPCP1-encoded protein precursor.

CHEN et al. ¡X Sweet potato cysteine protease SPCP1

163

Q139, C145, H282, and N303 amino acids of SPCP1

labelled with asterisks and printed in white on black were

identified as conserved catalytic residues (Figure 1).

Southern blot hybridization showed that there was about

six, six, and three bands detected for digestion with EcoRI,

HindIII, and XbaI, respectively, with SPCP1 probe (Figure

2). These data suggest that SPCP1 encodes a putative

cysteine protease, which may comprise multiple copy

number in sweet potato genome.

gene expression of SPCP1 is enhanced in

naturally senescent leaves

SPCP1 gene expression was significantly enhanced

during natural leaf senescence. The stages of leaf

senescence was divided into S0, S1 and S2 according

to the contents of cellular chlorophylls (a + b). S0 is the

mature green leaf and its chlorophylls (a + b) is assigned

as 100%. S1 and S2 are senescent leaves with 40% and

10% chlorophylls (a + b), respectively. The amplified

PCR products were remarkably increased at S1 and S2

senescent leaves, however, was almost not detected in S0

mature green leaves, root, and stem. A metallothionein-

like protein gene G14, which was isolated previously

from sweet potato leaves and exhibited constitutive

expression pattern in all tissues assayed (Chen et al.,

2003), was used as a control. No significant variation

of G14 gene expression level was found among tissues

and stages analyzed (Figure 3A). These data suggest

that SPCP1 is likely a senescence-associated gene and

exhibits an enhanced expression pattern during natural leaf

senescence.

Figure 2. Southern blot hybridization of sweet potato SPCP1.

T he genomic DNA of sweet potato was digested with restric-

t ion enz ymes (EcoRI, HindIII, or XbaI) and detected with

the digoxigenin-labelled SPC P1 probe.

Fig ure 3. Te mporal and spatial gene expre ssion of sweet

potato S PCP1 detected with semi-qua ntitative RT-PCR and

Western blot. (A) RT-PCR products. The ampl ified SPC P1

RT-PCR produc ts were de te cte d wi th et hidi um bromide

st aining (Et Br stai ning) a nd non-radioactive digoxigeni n-

labelled SPCP1 cDNA probe. (B) Western blot. Western blot

was performed with the polyclonal antibody raised against

SPCP1. S0, S1, and S2 represented different senescent stages

(100%, 40%, and 10% chlorophylls (a + b), respectively) of

leaves. G14 , which encoded a m etallot hionein-li ke protein

and exhibited a constitutive expression pattern, was used as

a control. The experiments were performed three times and

a representative one was shown. (C) Activit y staining. The

crude protein extract from S2 leaves was analyzed for pro-

tease activity in the presence or absence of inhibitor E-64 in

gelatin-containing polyacrylamide gel.

164

Botanical Studies, Vol. 50, 2009

Western blot hybridization with polyclonal antibody

raised against SPCP1 showed that a band with a molecular

mass around 36 kDa was detected and its amount increased

remarkably at S2 stage (Figure 3B). The data are consistent

with the semi-quantitative RT-PCR results (Figure 3A) and

provide further evidence to support SPCP1 as a functional

gene. Protease activity staining with S2 senescent leaves

in gelatin-containing polyacrylamide gel showed that

an activity band with a molecular mass about 50 kDa

was detected and insensitive to inhibitor E-64 inhibition.

However, the activity band with a molecular mass around

36 kDa exhibited sensitivity to inhibitor E-64 inhibition

(Figure 3C). Cysteine proteases are in general sensitive

to E-64 protease inhibitor (Mitsuhashi et al., 2004),

however, proteases such as asparaginyl endopeptidase (an

atypical cysteine endopeptidase) has been reported with

insensitivity to inhibitor E-64 (Okamoto and Minamikawa,

1999). These data suggest the existence of cysteine

proteases with a molecular mass ca. 36 kDa.

SPCP1 gene expression is enhanced by dark,

ethephon, and ABA

Induction of SPCP1 gene expression was studied

with detached mature green leaves. For dark treatment,

contents of chlorophylls (a + b) decreased gradually and

the amount at day 12 was about one third that of day 0.

Gene expression of SPCP1 was not significantly increased

from day 0 to day 3; however, was remarkably enhanced

from day 6 till day 12. For G14, no significant variation

was found in dark treatment (Figure 4A). Western blot

hybridization also detected a band with molecular weight

around 36 kDa, which gradually increased from day 6 till

day 12 (Figure 4B).

For 1 mM ethephon treatment, loss of contents of

chlorophylls (a + b) from treated mature green leaves were

much faster than that of the untreated dark control and the

amount at day 3 was about one third that of day 0. The

semi-quantitative RT-PCR products of SPCP1 increased

from day 2 to day 3 in ethephon-treated samples, whereas,

no significant change of SPCP1 from the untreated dark

controls was observed. The increased amounts in ethephon

treated samples were much higher and faster than that of

the untreated dark controls from day 2 to day 3, and were

correlated with the rate of leaf senescence using changes

of pigment contents as a senescent indicator. For G14,

no significant variation was found in ethephon treatment

(Figure 5A). Western blot hybridization detected a band

with molecular mass around 36 kDa from day 2 till day 3

after ethephon treatment (Figure 5B), which is consistent

with the semi-quantitative RT-PCR results (Figure 5A).

Figure 4. Effects of dark treatment on S PCP1 gene expres-

sion in detached mature green leaves within a 12-day period.

(A) RT-PCR products. Changes of S PCP1 RT-PCR products

in dark-treated mature green leaves were detected with ethid-

ium bromide (EtBr) st aini ng and non-ra dioa ctive digoxi-

genin-labelled SPC P1 probe. G14, which encoded a metallo-

thionein-like protein and exhibited a constitutive expression

patte rn, wa s used as a c ontrol. D denotes dark t reatme nt.

(B) Western blot. Western blot was performed with the poly-

clonal antibody raised against SPCP1. The experiments were

performed three times and a representative one was shown.

F igur e 5. Effect of ethephon, an ethylene-releasing com-

pound, on S PCP1 gene expression in detached mature green

leaves within a 3-day period. (A) RT-PCR products. Changes

of SPC P1 RT-PCR products i n 1 m M ethephon-treated and

dark-treated mature green leaves were detected with ethid-

ium bromi de (Et Br) stai ning a nd non-ra dioact ive digoxi-

genin-labelled S PC P1 probe. G14 , which encoded a metallo-

thionein-like protein and exhibited a constitutive expression

pattern, was used as a control. E and D denote ethephon and

dark treatments, respectively. (B) Western blot. Western blot

was performed with the polyclonal a ntibody raised against

SPCP1. The experiments were performed three times and a

representative one was shown.

CHEN et al. ¡X Sweet potato cysteine protease SPCP1

165

For 100 £gM ABA treatment, loss of chlorophylls

(a + b) from treated mature green leaves were also faster

than that of the untreated dark control and the amount

at day 5 was about 22% that of day 0. SPCP1 gene

expression significantly increased from day 1 to day 5 in

ABA-treated samples compared to that of untreated dark

controls, and were correlated with leaf senescence. For

G14, no significant variation was found in ABA treatment

(Figure 6A). Western blot hybridization detected a band

with molecular mass around 36 kDa at day 3 after ABA

treatment (Figure 6B), which is consistent with the semi-

quantitative RT-PCR results (Figure 6A). These data, thus,

support SPCP1 as a functional, senescence-associated

gene, and its gene expression was enhanced in dark-,

ethephon-, ABA-induced senescent leaves.

SPCP1 was induced by ethephon in suspension

cells

Sweet potato cell suspension were used to study

ethephon effects on cell growth and SPCP3 gene

expression. The growth curve of sweet potato suspension

cells was shown in Figure 7A. It took ca. 9 to 12 days

after subculture for suspension cells to reach the stationary

phase. For 1 mM ethephon treatment, cell growth was

repressed ca. 18% that of untreated control at day 3,

however, was not significantly different at day 6. For

F i gure 6 . E ffec t of ABA on SPCP1 gene expression in

de tac he d m ature gree n lea ve s wit hin a 5-da y period. (A)

RT-PCR products. Changes of SPC P1 RT-PCR products in

100 £gM ABA-treated and dark-treated m ature green leaves

were det ected wit h ethidium bromide (EtBr) staini ng and

non-radioactive digoxigenin-labelled SPCP1 probe. G14,

which encoded a metallothionein-like protein and exhibited

a constitut ive expression pattern, was used as a control. A

a nd D denote ABA a nd dark treat ments, re spectively; (B)

Wester n blot. We ste rn blot was performed with the poly-

clonal antibody raised against SPCP1. The experiments were

performed three times and a representative one was shown.

Figu re 7. The effects of 1 mM ethephon on cell growth and

induction of SPCP1 in suspe nsion culture. (A) The growth

cu rve of swee t pot ato suspe nsion cel ls wa s de te rmi ned

withi n a 18-day period of culture, and the fresh weight of

cells were measured at day 0, 1, 3, 6, 9, 12, 15 and 18 after

subculture. (B) The effect of 1 m M ethephon on cell growth

in suspension culture. Control and 1 mM HCl + 1 mM H

3

PO

4

denote untreated control and control treated with 1 mM HCl

+ 1 m M H

3

PO

4

, respe ctively. (C) T he induction of SPCP1

by 1 mM ethephon in suspension cells. C and E denote the

control treated wit h 1 m M HCl + 1 mM H

3

PO

4

and 1 mM

ethephon-t reated sample, respectively.

166

Botanical Studies, Vol. 50, 2009

control treated with 1 mM HCl and 1 mM H

3

PO

4

, cell

growth was also slightly repressed ca. 8% that of untreated

control at day 3, and was almost the same at day 6 (Figure

7B). Western blot hybridization showed that SPCP1 was

significantly induced and enhanced to express by 1 mM

ethephon compared to control treated with 1 mM HCl and

1 mM H

3

PO

4

at day 1 and day 3 (Figure 7C). Evan blue

staining showed that the nuclei of most cells were not

stained and was viable in untreated control, and treatments

with 1 mM or 2 mM ethephon. However, the nuclei of

most cells were stained blue and died in 10 mM ethephon

treatment. These results conclude that 1 mM ethephon

do not drastically cause cell death in cell suspension,

however, can induce SPCP1 gene expression in cell

suspension culture.

DISCUSSION

Sweet potato SPCP1 encoded a putative papain-like

cysteine protease, and its ORF contained 339 amino

acids (Figure 1). The predicted molecular mass was ca.

34 kDa. Western blot hybridization and protease activity

assay detected a band with molecular mass near 36 kDa

(Figure 3). The protease activity band was also sensitive to

inhibitor E-64. In carrot cell suspemsion culture, different

cysteine proteases with sequential development of protease

activities during somatic embryogenesis were observed

and exhibited sensitivity to E-64 protease inhibitor

(Mitsuhashi et al., 2004). These data provide evidence to

support the existence of a functional cysteine protease with

a molecular mass near 36 kDa for SPCP1 in sweet potato

senescent leaves.

Sweet potato SPCP1 gene expression was significantly

enhanced at mRNA and protein levels in natural and

induced senescent leaves (Figures 4, 5 and 6). Gene

expression of nodule-specific papain-like cysteine

proteases, such as AsNOD32 of Chinese milk vetch

(Astragalus sinicus) (Naito et al., 2000) and Tr-cp of

white clover (Trifolium repens) (Asp et al., 2006) were

detected in the senescing zone and correlated with the

onset of nodule senescence. In Arabidopsis, papain-like

cysteine protease SAG12 was detected mainly localized in

senescence-associated vacuoles of mesophyll and guard

cells of senescing leaves (Otegui et al., 2005). Our results

agree with these reports and support sweet potato SPCP1

a senescence-associated gene. In sweet potato, SPCP1

Figure 8. Evan blue staining of ethephon-treated sweet potato suspension cells. The suspension cells were t reated with 0, 1, 2,

and 10 m M ethephon, respectively, for 3 days, then were harvested and stained with Evan blue staining dye. (A), (B), (C), and

(D) denote 0, 1, 2, and 10 mM ethephon-treated samples, respectively.

CHEN et al. ¡X Sweet potato cysteine protease SPCP1

167

gene expression level could be induced by dark, ethephon,

and ABA (Figures 4, 5, and 6). Buchanan-Wollaston et

al. (2005) analyzed gene expression patterns and signal

transduction pathways of senescence in Arabidopsis

induced by different factors, including dark, starvation,

ethylene, ABA, salicylic acid, and jasmonic acid (JA).

Transcriptome analysis revealed that pathways such as

dark, ethylene, and JA are all required for expression of

many genes during developmental senescence. Genes

associated with essential metabolic processes such

as nitrogen degradation and mobilization can utilize

alternative pathways for induction (Buchanan-Wallaston

et al., 2005). These data provide a possible explanation

for the induction of sweet potato SPCP1 gene expression

by different factors such as development, dark, ABA, and

ethephon possibly due to or in association with multiple

signal transduction pathways.

In natural and induced senescent leaves, the chlorophyll

contents were used as a marker to indicate the senescence

levels. During senescence, cysteine protease SPCP1

expression was induced and enhanced. However, the time

o f SPCP1 expression was later than the initiation time

of chlorophyll degradation and decrease of chlorophyll

content (Figures 4, 5 and 6). Therefore, the possible

function of SPCP1 may not be directly in association with

the initiation of chlorophyll degradation. In Arabidopsis,

transgenic plants expressing SAG12-GFP fusion protein

under the control of SAG12 promoter demonstrated

that SAG12 was mainly localized in the senescence-

associated vacuoles of chloroplast-containing mesophyll

and guard cells in senescing leaves (Otegui et al., 2005).

In tobacco, the senescence-associated vacuoles contain

soluble chloroplast stromal proteins, including Rubisco

and glutamine synthase, but lack the thylakoid proteins,

such as D1 protein, LHCII of the PSII reaction center

and PSII antenna. The Rubisco levels decreased steadily

in senescence-associated vacuoles incubated at 30¢XC,

and was completely abolished by addition of protease

inhibitors (Martinez et al., 2008). Our results agree with

these reports and suggest that sweet potato SPCP1 may

not be directly in association with chlorophyll degradation

during leaf senescence.

In sweet potato, SPCP1 gene expression level is higher

in ethephon-induced senescent leaves (Figures 5 and

7C). The effect of ethephon as a senescence accelerator

is indirect. It is first decomposed into HCl, phosphate

and ethylene in a 1:1:1 ratio before the ethylene action.

In order to prevent the side effects caused by HCl and

phosphate, final concentrations of 1 mM HCl and 1 mM

phosphate were added to the medium as a control when

1 mM ethephon was used for treatment. No significant

effects of HCl and phosphate at the concentration applied

o n SPCP1 gene induction were concluded (Figures 5

and 7C). Leaf senescence is considered as a type of

programmed cell death (Lim et al., 2007). Leaf senescence

was induced by 1 mM ethephon treatment (Figure 5).

However, 1 mM ethephon treatment did repress cell

growth at the beginning, but did not cause significant cell

death in suspension cells (Figures 7 and 8). SPCP1 gene

expression was induced and enhanced drastically in both 1

mM ethephon-treated mature green leaves and suspension

cells. These data suggest that SPCP1 gene expression

may not be directly in association with programmed cell

death. In tobacco, different markers, such as senescence

marker (SAG12) and HR cell death markers (HIN1 and

HSR203J), were used to study the programmed cell death

(PCD) caused by incompatible pathogen interaction and

senescence. The HSR203J is upregulated during HR but

not during leaf senescence. However, Arabidopsis SAG12

gene expression is associated with leaf senescence but is

not detected in the HR PCD (Pontier et al., 1999). With

T-DNA insertion mutagenesis, a sag12-2 Arabidopsis

mutant was generated and used to study the correlation

of phenotypic effect and gene expression with wild type.

SAG12 gene expression was detected in wild type, but

not in sag12-2 mutant. However, absence of altered

senescence phenotype could be observed between wild

type and sag12-2 mutant (Otegui et al., 2005). These

results clearly demonstrated that SAG12 is not required for

the visual progression of leaf senescence, and support that

sweet potato SPCP1 may not be directly in association

with chlorophyll degradation and cell death during leaf

senescence. The dose of 1 mM ethephon treatment, which

caused leaf yellowing and final cell death in treated leaves,

however, did not induced significant cell death in treated

suspension cells (Figures 5, 7 and 8). The reason is not

clear. However, the variation of constituents between

(a) the medium for cell suspension culture (MS with 3%

sucrose, B5 vitamin, and 1 ppm 2,4-D) and (b) the buffer

for detached leaves (0.3 mM MES, pH 7.0) may partly

respond for the difference.

The possible physiological role and function of

SPCP1 in sweet potato senescent leaves are not clear.

I n Arabidopsis, SAG12 was expressed in nitrogen

deprivation-induced senescence, and correlated at

the whole plant level with the sink/source transition

for nitrogen during both developmental and nutrient

sress-induced leaf senescence (Gombert et al., 2006).

Senescence-associated vacuoles were involved in the

degradation of soluble chloroplast stroma proteins

in tobacco leaves (Martinez et al., 2008). In castor

bean (Ricinus communis L.), a papain-like cysteine

protease with a C-terminal KDEL was immunolocalized

specifically in ricinosome, which was organelles co-

purified with glyoxysomes from germinating Ricinus

endosperm, a senescing tissue (Schmid et al., 1998). The

papain-like cysteine endoprotease has the capacity to

process the glyoxysomal malate dehydrogenase precursor

protein into the mature subunit in vitro (Gietl e al., 1997).

These data suggest a possible role for these papain-

like cysteine proteases in association with the clevage

and maturation of proproteinases that are involved in

macromolecule degradation and re-mobilization during

leaf senescence. Whether sweet potato SPCP1 play a

role in association with macromolecule degradation and

remobilization as mentioned above await for further

168

Botanical Studies, Vol. 50, 2009

investigation. We conclude that sweet potato SPCP1 is

a functional senescence-associated gene with cysteine

protease activity. It is not directly in association with

chlorophyll degradation and programmed cell death during

leaf senescence.

Acknowledgment. The authors thank the financial

support (NSC95-2313-B-110-006-MY2) from the National

Science Council, Taiwan.

lITeRATURe CITeD

Asp, T., S. Bowra, S. Borg, and P.B. Holm. 2004. Cloning and

characterization of three groups of cysteine protease genes

expressed in the senescing zones of white clover (Trifolium

repens) nodules. Plant Sci. 167: 825-837.

Buchanan-Wollaston V. 1997. The molecular biology of leaf

senescence. J. Exp. Bot. 48: 181-199.

Buchanan-Wollaston, V., T. Page, E. Harrison, E. Breeze, and

P.O. Lim. 2005. Comparative transcriptome analysis reveals

s ignificanct differences in gene expression and signaling

pathways between de velopmental a nd dark/starvation-

induced senescence in Arabidopsis. Plant J. 42: 567-585.

Chen, H.J., W.C. Hou, W.N. Jane, and Y.H. Lin. 2000. Isolation

a nd chara cteri zati on of an is ocitra te lya se gene from

s enescent leaves of s we et potato (Ipomoea batatas cv.

Tainong 57). J. Plant Physiol. 157: 669-676.

Chen, H.J., W.C. Hou, J .S. Liu, C.Y. Yang, D.J. Huang, and

Y.H. Lin. 2004. Molecular cloning and characterization of

a cDNA encoding asparaginyl endopeptidas e from sweet

potato (Ipomoea batatas (L.) Lam) senescent leaves. J. Exp.

Bot. 55: 825-835.

Chen, H.J., W.C. Hou, C.Y. Yang, D.J. Huang, J.S. Liu, and Y.H.

Lin. 2003. Molecular cloning of two metallothionein-like

protein genes with differential expression patterns from

sweet potato (Ipomoea batatas (L.) Lam.) leaves. J. Plant

Physiol. 160: 547-555.

Chen, H.J., G.J. Huang, W.C. Hou, J.S. Liu, and Y.H. Lin. 2006.

Molecula r c loning and charac terization of a granul in-

containing cysteine protease SPCP 3 from sweet potato

(Ipomoea batatas) senescent leaves. J. Plant Physiol. 163:

863-876.

Chen, H.J ., I.C. Wen, G.J. Huang, W.C. Hou, and Y.H. Lin.

2008. Expression of sweet potato asparaginyl endopeptidase

ca us ed altered phenotypic characteristics in transgenic

Arabidopsis. Bot. Stud. 49: 109-117.

Gi etl, C., B. Wim mer, J . Adame c, and F. Kalous ek. 1997.

A cys t ein e e ndope pti das e is ola te d from ca st or be an

endosperm microbodies processes the glyoxysomal malate

de hydrogena se prec urs or protein. Pl ant P hys iol. 113:

863-871.

Goetting-Mines ky, M.P. and B.C. Mullin. 1994. Differential

gene expression in an actinorhizal symbiosis: Evidence for

a nodule-specific cysteine proteinase. Proc. Natl. Acad. Sci.

USA 91: 9891-9895.

Gombert, J ., P. Etienne, A. Ourry, and F.L. Dily. 2006. The

expression patterns of SAG12/Cab genes reveal the spatial

and temporal progression of leaf senescence in Br assica

napus L. with sensitivity to the environment. J. Exp. Bot.

57: 1949-1956.

Hattori, T., T. Nakagawa, M. Maeshima, K. Nakamura, and T.

Asahi. 1985. Molecular cloning and nucleotide sequence

of cDNA for sporamin, the major soluble protein of sweet

potato tuberous roots. Plant Mol. Biol. 5: 313-320.

Hou, W.C., Y.C. Chen, H.J. Chen, Y. H. Lin, L.L. Yang, and M.

H. Lee. 2001. Antioxidant activities of trypsin inhibitor,

a 33 kDa root s torage protein of sweet potato (Ipomoea

batatas (L.) Lam cv. Tainong 57). J. Agri. Food Chem. 49:

2978-2981.

Hou, W.C., H.J. Chen, and Y.H. Lin. 2003. Antioxidant peptides

with angiotens in converting enzyme inhibitory activities

and a ppli ca tions for a ngiot ens in conve rting enz yme

purification. J. Agri. Food Chem. 51: 1706-1709.

Huang, D.J., W.C. Hou, H.J. Chen, and Y.H. Lin. 2006. Sweet

potato (Ipomoea batatas [L.] Lam ¡¥Tainong 57¡¦) storage

root mucilage exhibited angiotensin converting enzyme

inhibitory activity in vitro. Bot. Stud. 47: 397-402.

Huang, G.J., H.J. Chen, Y.S. Chang, M.J. Shue, and Y.H. Lin.

2007a. Recombinant sporamin and its synthesized peptides

with antioxidant activities in vitro. Bot. Stud. 48: 133-140.

Huang, G.J., M.J. Sheu, H.J. Chen, Y.S. Chang, and Y.H. Lin.

2007b. Inhibition of reactive nitrogen species in vitro and

ex vivo by trypsin inhibitor from sweet potato ¡¥Tainong 57¡¦

storage roots. J. Agri. Food Chem. 55: 6000-6006.

Huang, G.J., M.J. Sheu, H.J. Chen, Y.S. Chang, and Y.H. Lin.

2007c. Growth inhibition and induction of apoptosis in

NB4 promyelocytic leukemia cells by trypsin inhibitor

from sweet potato storage roots. J. Agri. Food Chem. 55:

2548-2553.

Jonson, T., E.H. Mahlamaki, R. Karhu, L. Gorunova, B.

Johans son, and M. Huglund. 2000. Characterization of

genomically amplified s egments using PCR: Optimizing

relative-P CR for reliable and simple gene expression and

gene copy analyses. Gen. Chrom. Cancer 29: 192-199.

Lee, T.M. and Y.H. Lin. 1995. Trypsin inhibitor and trypsin-like

protease activity in air- or submergence-grown rice (Oryza

sativa L.) coleoptiles. Plant Sci. 106: 43-54.

L icht entha ler, H.K. 1987. Chloro phylls and ca roten oids :

pigments of photosynthetic biomembranes. Meth. Enzym.

148: 350-382.

Lim, P.O., H.J. Kim, and H.G. Nam. 2007. Leaf senescence.

Annu. Rev. Plant Biol. 58: 115-136.

Makino, A. and B. Osmond. 1991. Effects of nitrogen nutrition

on ni tr oge n p ar ti ti on in g b et we en ch lo rop la s ts an d

mitochondria in pea and wheat. Plant Physiol. 96: 355-362.

Martinez, D.E., M.L. Cos ta, F.M. Gomez, M.S. Otegui, and

J.J. Guiamet. 2008. "S enescence-as sociated vacuoles"

are involved in the degradation of chloroplast proteins in

tobacco leaves. Plant J. (Published Online 28 June, 2008).

CHEN et al. ¡X Sweet potato cysteine protease SPCP1

169

Marty, F. 1999. Plant vacuoles. Plant Cell 11: 587-599.

Mitsuhashi, W., T. Yamas hita, T. Toyom asu, Y. Kashiwagi,

and T. Konnai. 2004. Sequential development of cysteine

proteinase activities and gene expression during somatic

embryogenesis in carrot. Biosci. Biotechnol. Biochem. 68:

705-713.

Naito, Y., M. F ujie, S. Usami, Y. Murooka, and T. Yam ada.

2000. The involvement of a cyste ine proteinas e in the

nodule development in Chinese milk vetch infected with

Mesorhizobium huakuii subsp. Rengei. Plant Physiol. 124:

1087-1095.

Noh, Y.S. and R.M. Amasino. 1999. Regulation of

d e ve l op m e n ta l s e ne s c e n c e i s c o ns e rv e d be t we e n

Arabidopsis and Br ass ica napus . P lant Mol. Biol. 41:

195-206.

Okamoto, T. and T. Minamikawa. 1999. Molecular cloning

and characterization of Vigna mungo processing enzyme 1

(VmPE-1), an asparaginyl endopeptidase possibly involved

in post-trans lational proces sing of a vacuol ar c ys teine

endopeptidase (SH-EP). Plant Mol. Biol. 39: 63-73.

Otegui, M.S., Y.S . Noh, D.E.Ma rti nez, M.G. Vi la P etroff,

L.A. Staehelin, R.M. Amasino, and J .J. Guiamet. 2005.

Senescence-associated vacuoles with intense proteolytic

activity develop in leaves of Arabidopsis and soybean. Plant

J. 41: 831-844.

P ontier, D., S . Gan, R.M. Ama sino, D. Roby, a nd E . L am.

1999. Markers for hypersensitive response and sequence

show distinct patterns of expression. Plant Mol. Biol. 39:

1243-1255.

Pourtau, N., R. Jennings, E. Pelzer, J. Pallas, and A. Wingler.

20 06. E ffe ct of s uga r-i nd uc ed s en es c e nce o n g en e

expression and implications for the regulation of senescence

in Arabidopsis. Planta 224: 556-568.

Quirino, B.F., Y.S. Noh, E. Himelblau, and R.M. Amasino. 2000.

Molecular aspects of leaf senescence. Trends. Plant Sci. 5:

278-282.

Sambrook, J., E.F. F ritsch, and T. Maniatis. 1989. Molecular

Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor

Laboratory Press.

Schlereth, A, D. Standhardt, H.P. Mock, and K. Muntz. 2001.

S tored cysteine proteinases start globulin mobilization in

protein bodies of embryonic axes and cotyledons during

ve tch (Vi cia sat iva L.) s eed germ ination. P lanta 212:

718-727.

Schmid, M., D. S impson, F. Kalousek, and C. Gietl. 1998. A

cys teine endope ptidase with a C-term inal KDE L m otif

isolated from castor bean endosperm is a marker enzyme

for the ricinosome, a putative lytic compartment. Planta

206: 466-475.

Sihachakr, D., R. Haicour, J.M. Cavalcante Alves, I. Umboh,

D. Nzoghe , A. S erva es , and G. Duc reux. 1997. Pl ant

regeneration in sweet potato (Ipomoea batatas L.,

Convolvulaceae). Euphytica 96: 143-152.

Vierstra, R.D. 1996. Proteolysis in plants: mechanisms and

functions. Plant Mol. Biol. 32: 275-302.

Vincent, J.L., M.R.Knox, T.H. Ellis, P. Kalo, G.B. Kiss, and N.J.

Brewin. 2000. Nodule-expressed Cyp15a cysteine protease

genes map to syntenic genome regions in Pisum and

Medicago spp. Mol. Plant Microbe. Int. 13: 715-723.

Yang, T.H., Y.C. Ts ai, C.T. Hs eu, H.S . Ko, S.W. Chen, a nd

R.Q. Blackwell. 1975. Protein content and its amino acid

distribution of locally produced rice and sweet potato in

Taiwan. J. Chin. Agri. Chem. Soc. 13: 132-138.

Yoshida, S. 2003. Molecular regulation of leaf senescence. Curr.

Opin. Plant Biol. 6: 79-84.

170

Botanical Studies, Vol. 50, 2009