Botanical Studies (2007) 48: 1-11.

*

Corresponding author: E-mail: bocharng@ccms.ntu.edu.

tw; Tel: +886-2-33664774; Fax: +886-2-23620879.

INTRODUCTION

Rice has become a model for the study of monocot

plants because of the accumulating molecular information

for this species (Harushima et al., 1998; Sakata et al.,

2000; Temnykh et al., 2000; Yuan et al., 2000; for

review see Jeon and An, 2001). Rice also has a high

transformation efficiency (Tyagi and Mohanty, 2000),

a small (430 Mb) genome (Arumuganathan and Earle,

1991), and is economically important (David, 1991).

The complete DNA sequence for the rice genome is now

known. Questions are now being asked about the function

of the genes within it, and techniques are in development

to address these questions on a genome-wide, cross-

species scale. Because of the high degree of conservation

among the gene sequences and orders among cereals,

the structural and functional analyses of rice should have

broad practical implications for developing products and

technologies in both rice and other economically important

cereals. Mutants represent one of the most effective ways

to acquire information on a gene¡¦s function. Various

mutants, such as gene knockouts or null mutations, are

invaluable for understanding biological variability when

assigning functions to such a large quantity of sequence

information. To make full use of the information mutants

provide, developing methods that efficiently utilize vast

quantities of information regarding function are critical.

Transposon tagging has become a powerful tool

to create mutants for isolating new genes. Several

experimental approaches have been undertaken to

develop rice lines in which genes are randomly tagged

by insertion elements (Greco et al., 2001b; Hirochika,

2001, 2004; Izawa et al., 1997; Jeon and An, 2001).

Since the first introduction of maize Ac/D s into rice

(Izawa et al., 1991; Shimamoto et al., 1993), a variety of

modified constructs have been introduced into rice (Chin

et al., 1999; Greco et al., 2001a; Nakagawa et al., 2000).

Some important features of the Ac element have been

characterized in transgenic rice plants: for example (1)

The Ac element transposes in 18.9% of transformed rice;

(2) The transposed Ac element continues to transpose

and is transmitted to subsequent generations; (3) Ac

transactivates transposition of the non-autonomous Ds

element; (4) The germinal excision frequency of Ac could

be as high as 40%; and (5) Ac transposes preferentially

into protein-coding regions (Enoki et al., 1999). These

observations indicate that Ac/Ds gene tagging systems are

valuable for rice functional genomics. Although another

transposon system, En/Spm, has been introduced into rice

plants, its transposition efficiency seems quite low (Greco

et al., 2004). Later, Kumar et al. (2005) showed that the

En/Spm system works very well in rice. For the Ac/Ds

system, several successful transposon tagging experiments

The inducible transposon system for rice functional

genomics

Yuh-Chyang CHARNG

1,

*, Gideon WU

1

, Chia-Shan HSIEH

1

, Han-Ning CHUANG

1

, Ji-Ying

HUANG

1

, Ling-Chun YEH

1

, Ya-Hsiung SHIEH

1

, and Jenn TU

2

1

Department of Agronomy, National Taiwan University, No.1 Sec. 4 Roosevelt Rd., Taipei, Taiwan, Republic of China

2

Institute of Plant and Microbial Biology, Academia Sinica, Taipei, Taiwan, Republic of China

(Received January 17, 2006; Accepted May 11, 2006)

ABSTRACT.

The one-component inducible transposon system for rice functional genomic studies was

assessed. In contrast to the native Ac transposon, INAc contains the transposase gene under the control of the

inducible promoter (PR-1a) from tobacco. To examine whether INAc can be used in cereals, the behavior of

INAc was analyzed with transgenic rice plants containing a single copy of the INAc element. Treatment of

rice calli with salicylic acid induced transposition of INAc in somatic tissue, and the transposition efficiency

of INAc was dose dependent. Furthermore, a high throughput method for detection of new transposed INAc

was developed. Analyzing the flanking sequences of the transposed INAc indicated the independent insertions.

Given the fact that a number of different types of Ac/Ds vectors have been already examined in rice, the

importance of a "controlled" transposon system to yield knockout mutants or new transgenic plants was

discussed.

Keywords: Ac transposase; Inducible promoter; Salicylic acid; Transposon tagging.

MOLECULAR BIOLOGY

2

Botanical Studies, Vol. 48, 2007

in rice plants indicate that it is a valuable tool for rice

functional genomic studies (Zhu et al., 2003; Komatsu

et al., 2003; Zhu et al., 2004). However, one major

concern when using a native Ac element is that it could

undergo frequent excision from the target gene, resulting

in variegation. This disadvantage can be eliminated with

the use of a two-component system or a self-stabilizing

Ac derivative (Schmitz et al., 1994). However, the

integration of a stable non-autonomous element in the

target gene requires segregation of the two components,

which is very inconvenient. With this mind, we previously

designed an inducible one-component transposon, INAc,

and demonstrated that it could be induced to transpose in

dicotyledon plants (Charng et al., 2000 and 2004). Then,

in a review of strategies for producing rice gene tags,

Jeon and An (2001) suggested that the development of an

inducible transposable element system would be valuable.

This encouraged us in the present study to introduce the

INAc element into rice plants. We observed that the INAc

transposition events increase after applying the inducer,

salicylic acid (SA), and that this higher transposition

efficiency of INAc is dose dependent. In this paper,

we conclude with a discussion of the promotion of the

inducible transposon to perform rice functional genomic

studies.

MATERIALS AND METHODS

Plants and constructs

Construction of the plasmid pINAc and its introduction

into the Agrobacterium tumefaciens strain LBA4404 has

been reported previously (Charng et al., 2000). The rice

variety used in this study was Oryza sativa L. Japonica cv.

TNG67. Calli induced from immature rice seeds were co-

cultured with Agrobacterium using the methods described

by Hiei et al. (1994) and Toki (1997). Putative transformed

calli were selected with hygromycin B.

For induction experiments, the T1 rice seeds of each

transformed line were incubated on callus induction

medium (CIM) containing hygromycin for 4 weeks in

order to yield enough calli for induction experiments. The

effect of SA on INAc transposition was determined by

incubating Hyg

R

calli for various times on CIM containing

0 mM, 5 mM, or 10 mM SA. The calli from the same

seed were evenly divided (about 25 calli per plate) and

incubated on CIM containing 0 mM, 5 mM, or 10 mM SA

with respect to the induction time of 7, 5, and 3 days. The

calli were then transferred to CIM without SA for about 2

weeks before sampling for PCR analysis.

Isolation of genomic DNA and Southern

hybridization analysis

Genomic DNA was isolated from transformed plants

with the use of a kit (BIO 101, Vista, CA). In brief, fresh

leaves (2 g) or callus tissue (0.1 g) was frozen in liquid

nitrogen in a mortar and ground with a pestle. Nuclei were

isolated and lysed by protease treatment, and genomic

DNA was precipitated with ethanol and dissolved in TE

buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0). About

10 £gg of each DNA was digested with the appropriate

restriction enzyme under the conditions specified by

the suppliers and fractionated on 0.8% agarose gels (in

1¡ÑTAE) overnight at 1 V/cm. Southern analysis was

performed as described by Charng and Pfitzner (1994).

PCR analysis of

INAc

excision events

Transposition of INAc from the INAc::LUC construct

in transgenic plants was analyzed by polymerase chain

reaction (PCR) with three oligonucleotide primers: primer

1P (identical to the T-DNA promoter sequence from

position 285 to 303 as numbered by Velten et al. (1984),

5¡¦-GGTTGCCATGTCCTACACG-3¡¦); primer LUC2

(complementary to the luciferase coding sequence from

position 367 to 347 as numbered by De Wet et al. (1987),

5¡¦-GCGGGCGCAACTGCAACTCCG-3¡¦); and primer

AC1 (complementary to the Ac sequence from position

155 to 137 as numbered by Muller-Neumann et al. (1984),

5¡¦-ACCCGACCGGATCGTATCG-3¡¦). Each reaction

mixture contained ~0.1 £gg of template DNA, 0.25 £gg of

each primer, 0.2 mM deoxynucleoside triphosphates, 1 U

of Taq DNA polymerase, 10 mM Tris-HCl (pH 8.3), 50

mM KCl, 1.5 mM MgCl

2

, and 0.01% (w/v) gelatin. The

amplification protocol comprised 30 cycles of 1 min at 94

¢XC, 2 min at 55¢XC, and 2 min at 72¢XC and was performed

in a T-gradient Thermocycler (Biometra, Gottingen,

Germany).

The re-intergrated INAc after excision in transgenic

rice was analyzed by single-primer PCR with AC1 as the

primer, and the amplification protocol comprised 45 cycles

of 1 min at 94¢XC, 1 min at 32¢XC, and 3 min at 72¢XC.

The flanking sequences of the INAc element in

transgenic plants were amplified by TAIL-PCR analysis

with the following oligonucleotide primers: primer

AC8 (CCCGTTTCCGTTCCGTTTTC), primer AC2

(CTCGGGTTCGAAATCGATC), and primer AC10 (CG

GTTATACGATAACGGTCGGTAC), which are identical

to the Ac sequences from position 4446 to 4465, 4475 to

4493, and 4513 to 4536 as numbered by Muller-Neumann

et al. (1984), respectively. Three arbitrary degenerate (AD)

primers and the TAIL-PCR procedure were according to

a previous report (Liu et al., 1995), except in the present

study the primary TAIL-PCR contained about 150 ng of

rice genomic DNA.

RESULTS

INAc construct and transgenic rice plants

The construction of the plasmid pINAc has been

reported previously (Charng et al., 2000). This construct

was transformed into rice varieties Oryza sativa L.

Japonica cv. TNG67. 45 independent transformed lines

were collected for primary analysis. The results of induced

transposition of INAc were obtained from transformed rice

plants containing a single copy of INAc.

CHARNG et al. ¡X The inducible transposon in rice

3

Spontaneous transposition of INAc in rice

INAc transposes spontaneously in primary transformed

shoots of tomato harboring the INAc element. The first

step to assess the facilitation of INAc is to examine the

spontaneous transposition events in transgenic rice. We

analyzed genomic DNA from primary rice calli by PCR

analysis (Figure 1) and Southern blot analysis (Figure 2).

Two sets of primers were used to verify transposed vs.

un-transposed INAc elements. With the primers AC1 and

LUC2, a 580-bp PCR product was obtained with DNA

from Hyg

R

rice plants, which harbor the un-transposed

INAc element (Figure 1A).

With the primers 1P and

LUC2, a 670-bp PCR product was obtained with DNA

from transformed rice plants, indicating the excision of the

INAc element. As shown in Figure 1, the transformed lines

R7, R51 and R20 yielded a 580-bp fragment with primers

AC1 and LUC2 (Figure 1B) but yielded no product with

primers 1P and LUC2. These findings indicate that these

Hyg

R

rice plants represented successfully transformed

lines and that the INAc elements were stable without

induction treatment. In contrast, transformed line R44

yielded both a 580-bp fragment and a 670-bp fragment

with these two sets of primers, indicating that this rice

plant contained cells in which INAc had undergone

spontaneous transposition and cells in which it had not.

By using these two sets of primers, 8 out of 45 transgenic

rice showed spontaneous transposition (data not shown).

For the transformed lines yielding no 670-bp fragment,

the spontaneous transposition event was monitored during

the development of the T0 generation. PCR analysis

indicated that the un-induced INAc element remained

stable and transmitted to subsequent generations (data

not shown). Also, genomic DNA from these transformed

lines was subjected to Southern blot analyses. As probes,

the 1.4-kb Bam HI/Eco RV fragment comprising the

LUC reporter gene, and the 2.56-kb Bam HI fragment

comprising the transposase gene were used. The DNA

samples were digested with Eco RV and hybridized with

LUC probe. Figure 2 shows that the transformed lines

R7, R20, R44 and R51 yielded hybridizing fragments

of 23-kb, 10-kb, 13-kb and 13-kb, respectively. These

results demonstrate each transformed line harboring a

single copy of T-DNA. After removal of the LUC probe,

the same filter was hybridized with the TPase probe. In

Figure 1. Construction of the INAc element and PCR analysis of

its excision. (A) Structure of the INAc element and the location

of primers (shown as solid triangles) used for PCR analysis. The

INAc element contains a PR-1a::TPase fusion and a hygromycin

resistant gene (HPT). The sizes of expected PCR products (580-

and 670-bp before and after excision of INAc, respectively)

are indicated. The sequential primers for TAIL-PCR, Eco RV

site and probes for DNA blot analysis were also indicated. (B)

Ethidium bromide-stained agarose gel on which PCR products

were separated. PCR was performed with genomic DNA from

the indicated transformants and with the indicated primers .

The hatched boxes indicate the DNA fragments used as probes

for S outhern blot anal ysi s. La ne M, 100-bp DNA l adder.

Abbreviations: LB and RB, left and right borders of T-DNA; p,

1¡¦ promoter; HPT, hygromycin phosphotransferase gene; LUC,

luciferase gene.

Figu re 2. Southern blot hybridization of Eco RV digeste d

genomic DNAs isolated from different transgenic rice lines with

the LUC probe or with the TPase probe (for construction see

Figure 1). The LUC probe (left) revealed the T-DNA copy and

together with the TPase probe (right) revealed the un-transposed

(indicated by the arrow) or transposed INAc (star).

4

Botanical Studies, Vol. 48, 2007

agreement with the PCR experiment, the transformed lines

R7, R20 and R51 yielded the same hybridizing patterns,

indicating the primary donor sites of the un-transposed

INAc element. For the transformed line R44, in addition to

the hybridizing fragment of 13-kb (un-transposed INAc),

bands of 14-kb and 7-kb indicated the transposition of

INAc (Figure 2).

Induction of INAc transposition

The fact that INAc transposition occurred spontaneously

in transformed line R44 indicates INAc is active in rice

plants. To determine whether the INAc element could be

induced in rice plants, we studied the induction of INAc

transposition using salicylic acid (SA) as the inducer in

transgenic rice calli and plants. The behavior of INAc

in rice plants was studied with T1 seed-derived calli

from four transformed rice lines, R7, R20, R44 and R51.

Lines R7, R20 and R51 contain a single copy of the

INAc element. The T1 rice seeds of each transformed

line were incubated on CIM containing hygromycin to

ensure the presence of the INAc element (transposed or

un-transposed). Each progeny line was established by

incubating the seed on CIM without SA, in order to yield

enough calli for induction experiments. The effect of SA

on INAc transposition was determined by incubating calli

for various times on CIM containing 0, 5 mM or 10 mM

SA. Since abundant calli could be regenerated from the

rice seeds on the CIM, the calli regenerated from each

seed (determined as an independent progeny line) were

then divided into three portions and incubated on CIM

with or without SA. Five Hyg

R

seeds each from lines R7,

R20, and R51 and 30 Hyg

R

seeds from line R44 were used

for induction experiments.

After the induction process, the regeneration calli

of each line were collected for DNA extraction. The

transposition events were determined by multiplex PCR

analysis using three primers: AC1, LUC2 and 1P. The

induced transposition efficiency of each transformed line

was determined by the presence of the 580-bp fragment

and/or the 670-bp fragment as shown in Figure 3 for

progeny lines from R7, R20 and R51. For progeny lines

of R44, the presence of the PCR products were expressed

as "X" or "O" as described in Table 1. It is notable that

exposure to 10 mM SA resulted in a marked decrease in

the efficiency of callus regeneration. For some progeny

lines treated with 10 mM SA, new calli formation was

not observed, even after four weeks of propagation. For

these progeny lines, DNAs could not be extracted for PCR

analysis and are expressed as "¢w" (Table 1).

For transformed lines R7, R20 and R51, in which no

spontaneous transposition event was detected, all un-

induced progeny lines yielded a 580-bp fragment and one

(line R50-1) out of 15 progeny lines also yielded a 670-bp

fragment. These findings suggest that a spontaneous

transposition event occurred in these transformed lines but

with low frequency. However, when these progeny lines

were treated with 5 mM SA, 8 out of 15 calli exhibited

transposition events; when these same line were treated

with 10 mM, 7 out of 11 calli exhibited transposition

events. In addition to the spontaneous transposition events

observed in un-induced progeny line R51-1, a 670-bp

product was also detected in SA-induced progeny lines

R7-2 (at both 5 mM SA and 10 mM SA), R7-4 (at both 5

mM SA and 10 mM SA), R20-1 (at 10 mM SA), R20-2

(at both 5 mM and 10 mM SA), R20-3 (at 5 mM SA),

R20-4 (at 5 mM SA), R20-5 (at both 5 mM and 10 mM

SA), R51-2 (at 5 mM SA), and R51-4 (at 10 mM SA). In

summary, these findings demonstrate that transposition

events were triggered under un-induced conditions with

0.6% efficiency while 5 mM- and 10 mM-SA induction

produced a 53% and 64% efficiency, respectively.

Taken together, these results show that the transposition

efficiency of INAc was induced by SA in a dose-dependent

manner. On the other hand, the transposition efficiency

in line R7, R20, and R51 was 40%, 80% and 20%,

respectively. These findings suggest that the location of

the INAc element in the plant genome also contributes to

the efficiency of transposition.

F igu re 3. PCR a na lysis for detec tion t rans position events

for progeny lines of R7, R20 and R51. E ach PCR reaction

was performed with 1P, AC1 and LUC primers. The reaction

yielded only 580-bp indicated un-transposed INAc. The reaction

yielded only 670-bp, indicating completely-trans pos ed INAc.

The reaction yielded both 670 and 580-bp, indicating partially-

transposed INAc. Lane M, 100-bp DNA ladder.

CHARNG et al. ¡X The inducible transposon in rice

5

Interestingly, among the progeny lines of the

transformed line R-44 that demonstrated spontaneous

transposition, 15 out of 30 un-induced progeny lines

yielded a 670-bp fragment when using primers 1P and

LUC2 (Table 1). These findings indicated that new

spontaneous transposition events occurred in the un-

induced progeny of transformed line R-44. When the same

30 progeny lines were treated with 5 mM SA, 29 lines

yielded a 580-bp fragment, and 24 lines yielded a 670-bp

fragment. Exposure to 10 mM SA resulted in a marked

decrease in the efficiency of callus regeneration, and hence

21 progeny lines were obtained for analysis. Among these

21 lines, 18 lines yielded a 580-bp fragment when using

primers AC1 and LUC2, and 19 lines yielded a 670-bp

fragment when using primers 1P and LUC2. Thus, the

transposition efficiencies of 0 mM SA- (spontaneous),

5 mM SA-, and 10 mM SA-induced progeny lines were

50%, 80% and 90%, respectively. These results suggest

that SA increases the frequency of production of the

670-bp product in a dose-dependent manner although,

as mentioned above, treatment of plants with 10 mM SA

resulted in a marked decrease in the efficiency of callus

regeneration.

Table 1. PCR analysis for detecting transposition events for progeny lines of R-44.

Induction

no SA

5 mm SA (5 days)

10 mm SA (3 days)

PCR products

Progeny lines 580-bp 670-bp Single primer 580-bp 670-bp Single primer 580-bp 670-bp Single primer

1

O

X

O

X

O

X

2

O

O

O

X

O

O

3

O

O

O

O

¡X

¡X

¡X

4

O

X

O

O

¡X

¡X

¡X

5

O

O

O

O

¡X

¡X

¡X

6

O

O

O

O

¡X

¡X

¡X

7

O

X

O

O

¡X

¡X

¡X

8

O

O

O

O

O

O

9

O

X

X

O

O

O

O

10

O

X

O

X

¡X

¡X

¡X

11

O

O

O

O

O

O

O

12

O

X

O

O

O

O

O

13

O

O

O

O

O

O

14

O

O

O

O

O

O

O

15

O

X

O

O

O

O

O

16

O

X

O

O

¡X

¡X

¡X

17

O

O

O

O

O

O

18

O

X

O

O

O

O

19

O

O

O

O

O

O

O

20

O

O

O

O

O

O

21

O

X

O

X

X

O

22

O

O

O

O

O

O

23

O

X

O

O

X

O

24

O

X

O

X

¡X

¡X

¡X

25

O

O

O

O

¡X

¡X

¡X

26

O

X

O

O

X

O

27

O

O

O

O

O

X

28

O

O

O

O

O

O

O

O

29

O

X

O

X

O

O

30

O

X

O

O

O

O

"O": symbol denotes the existence of PCR products (580-bp products for primers AC1 and LUC2; 670-bp products for primers 1P and

LUC2; different size patterns for single primer (AC1) PCR; "X": no PCR product; "¡X": DNAs were not extracted for PCR analysis.

6

Botanical Studies, Vol. 48, 2007

It is important to understand why some SA-induced

progeny lines yielded both a 580 bp and a 670 bp product

while others yielded only one of these products. Typical

examples of this phenomenon were in progeny lines

R20-2 (Figure 3, 10 mM SA induction), and R44-21,

-23, and -26 (Table 1, 10 mM SA induction). When these

progeny lines were incubated on CIM without SA, only

a 580-bp fragment could be detected. When these same

progeny lines were induced with 10 mM SA, only a

670-bp fragment could be detected. When progeny line

R44-23 and R44-26 were induced with 5 mM SA, both a

580-bp fragment and a 670-bp product could be detected.

It is likely that in these SA-treated progeny lines, INAc

was transposed in most cells after 10 mM SA treatment.

As a result, no 580-bp fragment was yielded when using

AC1 and LUC2 primers for PCR analysis. We found that

this phenomenon could also serve as an additional method

to determine the effect of SA concentration. In Table 1,

the transposition events of each progeny line with various

treatments were interpreted as an un-transposed line,

a partially-transposed line, or a completely-transposed

line. The un-transposed lines were determined as those

lines which yielded only a 580-bp fragment but no

670-bp fragment, e.g., progeny line R44-1 and R44-24.

The partially-transposed lines were determined as those

lines which yielded both a 580-bp fragment and a 670-bp

fragment, e.g., progeny lines R44-3 to R44-8 (Table 1,

5 mM SA induction) and R7-2 (Figure 3, 5 and 10 mM

SA induction). The completely-transposed lines were

determined as those lines which yielded only a 670-bp

fragment but no 580-bp fragment, e.g., progeny lines

R20-2 (Figure 3, 5 mM and 10 mM SA induction), and

R44-21, -23 and -26 (Table 1, 10 mM SA induction). The

SA-induced transposition efficiency was then measured

by the percentage of un-transposed, partially-transposed,

and completly-transposed progeny lines of an individual

transformed line. Using this method, we observed that

partially-transposed efficiency reached 50%, 77% and

76% in un-treated, 5 mM SA- and 10 mM SA-treated

progeny lines, respectively. Furthermore, completedly-

transposed efficiency reached 0%, 3% and 14% in un-

treated, 5 mM SA- and 10 mM SA-treated progeny lines,

respectively. Once again, these results demonstrated

that SA can induce the expression of PR-1a::TPase and

transposition events in transgenic rice plants in a dose-

dependent manner.

Detection of new transposition rice lines and

the flanking genomic DNA

An important feature of an inducible transposable

element for functional genomic studies is its tendency

to create new transposition lines after induction. Thus, a

high throughput method for screening the independent

transposants (transposition lines) markedly increases

the probability of success of transposon tagging when

attempting to isolate important plant genes. Toward this

end, in the present study we developed an identification

system for new transposants in rice plants based on the

single-primer PCR concept described by Karlyshev et

al. (2000). The procedure involves just one transposon-

specific primer and a single PCR reaction involving

a low annealing temperature (32¢XC) for amplification

of the region adjacent to the transposon insertion site.

Amplification of this region is possible because at low

annealing temperatures, the primer will bind to sites

of limited sequence complementarity that are on the

opposite strand from the specific primer binding site and

close enough to the transposon insertion site for PCR to

work. Subsequently, when the single primer PCR results

indicate the existence of new independent transposants,

the flanking sequence of the re-integrated INAc can be

obtained by the TAIL-PCR technique.

As indicated in Table 1, the DNA extracts prepared

from the progeny lines of R44 were analyzed by single-

primer PCR. Principally, a single-primer PCR reaction

produces several bands composed of specific and non-

specific products. In this experiment, one end of the

specific products was primed by AC1 containing a portion

of DNA (155-bp) identical to the end of INAc while the

non-specific products were amplified from the unknown

sequence dispersed on the chromosome. All un-transposed

progeny lines of R44 principally yielded the same DNA

pattern, composed of non-specific products and/or a

specific product. However, when the INAc element was

transposed from the original site and integrated into

another site on the chromosome, observing different

DNA patterns by a single-primer PCR analysis became

possible. Figure 4 presents a typical example of this

analysis. For most of the progeny lines, single-primer PCR

produced three major bands of 600-bp, 800-bp and 1.3-kb

in size. However, for progeny line R44-14 (with 5 mM

SA treatment), a 450-bp band was detected instead of a

800-bp band. These results indicate that for progeny lines

harboring the un-transposed INAc, the 800-bp band was

the specific product primed by the AC1 primer. Additional

bands of various sizes but larger than 155-bp indicate new

and different transposition sites of INAc. For example, the

appearance of the 450-bp band in progeny line R44-14

strongly suggested a new transposition site of INAc.

According to this, we detected 2 out of 30 progeny lines

(no SA), 3 out of 30 progeny lines (5 mM SA-treated) and

3 out of 21 progeny lines (10 mM SA-treated) of R44 that

yielded new PCR product patterns (Table 1).

The experiments were expanded to amplify the

flanking sequences of the T-DNA and the transposed

INAc elements. Genomic sequences flanking the INAc

transposons were isolated from transgenic lines of

R-44 and R-20 with induced somatic transposition, due

to observation of the new single-primer PCR product

patterns. The flanking sequences were isolated using

TAIL PCR (Liu et al., 1995, see Materials and Methods).

Three specific primers AC8, AC2, and AC10 were used

for the primary, secondary, and tertiary PCR reactions,

respectively (Figure 1). A summary of the significant

homologies obtained after comparison of the flanking

sequences obtained in public database is shown in Table

CHARNG et al. ¡X The inducible transposon in rice

7

2. For the transformed line R-20, only 1 out of 3 calli

showed an un-linked transposition event of INAc, yet for

the transformed line R-44, 4 out of 6 calli harbored the

transposed INAc un-linked to the T-DNA. These results

indicate that the independent transposition events of INAc

could be induced efficiently by SA.

DISCUSSION

Rice, with its small genome size and well-characterized

molecular information, is an ideal model plant for cereal

genomics research. The entire sequence of the rice (Oryza

sativa) genome has been determined by the International

Rice Genome Sequencing Project (IRGSP). Still, based on

current technologies, a large population of mutant plants

will likely be required to adequately assign function to the

abundance of sequence information.

Jeon and An have summarized various strategies

for producing gene tags that may be invaluable for

understanding the functional genomics of rice (2001).

Both T-DNA and Ac element have been used as the

insertional mutagen for rice gene tagging. Previously,

we reported an inducible transposable element for higher

plants (Charng et al., 2000). In the present study, we

studied the activity of INAc in order to further develop rice

gene tagging systems.

For the INAc construct, the native PR-1a promoter was

fused with the transposase gene of the Ac element, and

this PR-1a::TPase construct was inserted together with

the HPT gene directly into a small Ds element (Figure

1A). The resulting INAc element was placed between

the 1¡¦ promoter and the LUC gene. In principal, LUC

expression should be triggered after excision of the

transposable element. However, when the INAc construct

Figure 4. S i n g l e - pr i m e r

P C R a n a l y s i s o f t he n e w

t r a n s p o s i t i o n e v e n t s o f

INAc. G eno m ic DNA from

transformed rice progeny lines

were s et for P CR rea ctions ,

whi ch co nta i ned onl y A C1

p ri m er, a nd t he an ne a l in g

temperature was set as 32¢XC.

Table 2. Genomic sequences flanking INAc insertions in transgenic rice plants. The T-DNA integration site of each line is indicated

after its designation.

Line

Chromosome

BACs/PACs Insertion position (bp) GenBank accession no. Identities

R-44

(T-DNA) 3

OJ1124_H03

135923

AC087852

102/102 (100%)

0-11

10

OSJNBa0041L14

76009

AC099042

340/352 (96%)

0-28

1

P0443D08

120609

AP003250

467/478 (97%)

5-9

nd

nd

nd

nd

nd

5-14

3

OSJNBb0081B07

85729

AC093018

67/67 (100%)

5-28

9

P0528B09

88111

AP004703

89/89 (100%)

10-12

10

*Pseudo10p0.0-10p4.4

768203

AC145127

(100%)

10-15

nd

nd

nd

nd

nd

10-19

3

OSJNBa0002I03

72340

AC091246

40/40 (100%)

R-20

(T-DNA) 12

5-2

9

OSJNBa0047P18

154242

AP005864

47/47 (100%)

12

OSJNBa0014C10

45261

AL731787

27/27 (100%)

10-5

12

OSJNBa0052H10

29041

BX000494

104/104 (100%)

"nd": indicates no detectable product is obtained after TAIL PCR amplification.

8

Botanical Studies, Vol. 48, 2007

was introduced into rice plants, our preliminary analyses

indicated that although the transposition events could be

detected by PCR analysis, no luciferase activities were

detected (data not shown). This result is likely because the

1¡¦ promoter is less functional in rice plants. Consequently,

we set out to determine the transposition events using

PCR analysis. 8 out of 45 primary transformed rice lines

yielded a 670-bp band with primers 1P and LUC2 in the

absence of the inducer SA. This result is likely attributable

to activation of the PR-1a promoter by nearby enhancer

elements in the plant genome (Beilmann et al., 1992).

In the transformed lines that exhibited no spontaneous

transposition events, the INAc element remained stable

during the development of the plant, and it was transmitted

to the next generation (data not shown). The induction

experiments were performed with the T1 progeny lines,

which harbored the INAc element. We used PCR to

determine transposition events by observing the 670-bp

fragment with primers 1P and LUC2. The results shown in

Figure 3 and Table 1 demonstrate that transposition events

could be induced by SA treatment (5 mM or/and 10 mM)

calli with various efficiencies. Generally, we incubated

rice seeds on CIM for 4 weeks to produce enough calli for

induction experiments. Spontaneous transposition events

may have occurred during this calli regeneration process.

Since the calli produced for induction experiments were

divided into three equal portions prior to any artificial

stimulation for transposition, it would seem that a

spontaneous transposition event would happen equally in

all three portions of the calli (control, 5 mM or 10 mM

SA-treated). However, the fact that only one transposition

event (1 out of 15) was detected in un-treated calli of

progeny lines from R20, R7 and R50 strongly suggests

that the transposition events detected in SA-treated calli

mainly resulted in response to the induction treatment.

For those calli regenerated from the transformed line

R44, in which spontaneous transposition events were

detected in the T0 generation, it was necessary to consider

that the 670-bp products detected in the SA-treated calli

may have been spontaneous transposition events before

or during SA treatment. To rule out this possibility,

we determined the induced transposition events and

efficiencies by comparing the presence of both a 580-bp

(un-transposed) and a 670-bp (transposed) product.

Any 670-bp product with primers 1P and LUC2 was

recorded as a transposition event (spontaneous or non-

spontaneous). The transposition efficiencies were based

upon the presence of a 670-bp product in the progeny lines

of transformed line R44. We found that, the transposition

efficiency of un-induced, 5 mM SA- and 10 mM SA-

treated R44 progeny lines were 50%, 80% and 90%,

respectively. Alternatively, for progeny lines R44-24,

R44-34 and R44-55, 10 mM SA-treated calli yielded only

a 670-bp fragment but no 580-bp product. This was likely

because transposition events were triggered in most cells

of these calli, and hence the un-transposed INAc could

not be detected. We considered these calli as completely-

transposed after treatment. The presence of completely-

transposed calli from each progeny line served as a means

to determine the effect of SA concentration. On this basis,

completedly-transposed efficiency reached 0%, 3% and

14% by the un-treated, 5 mM SA- and 10 mM SA-treated

progeny lines, respectively. Taken together, these results

strongly suggest that the transposition efficiency of INAc

can be induced by SA in a dose-dependent manner.

An important feature of an inducible transposable

element is its ability to induce transposition in germinal

tissue. Induction of the germinal transposition in rice

is supposedly more complicated than in tobacco, since

the rice floral tissues embed themselves in the flag

leaves when (or before) meiosis occurs. For our primary

induction experiments, the highest germinal transposition

efficiency was detected by flooding the transgenic rice

with 5 mM SA solution; two out of 40 R20 progeny

lines showed transposition events under those condition,

indicating a 5% germinal transposition efficiency (data

not shown). Compared with the germinal transposition of

the native Ac element in rice (up to 40%; Nakagawa et al.,

2000), optimization of induction conditions for germinal

transposition of INAc requires further experimentation.

Still, since rice is an ideal model plant due to the

availability of its complete DNA sequence and its high

regeneration efficiency from calli, even heterozygous

mutants created by INAc are also valuable for reverse

genetics. We believe that the induced INAc-mutants

regenerated from rice calli are also valuable.

Our experiences in the present study lead us to suggest

a procedure for inducible transposon tagging in rice.

First, the INAc was induced to create abundant mutant

lines. Then, as a high throughput tool, the single-primer

PCR method was used to identify the new transposants.

Finally, these transposants were collected for TAIL-PCR

to identify the flanking sequence of the INAc element.

By aligning the DNA sequences obtained from the TAIL-

PCR technique to ensure the existence of the region from

the specific primer for tertiary TAIL-PCR (primer AC10

in this paper) to the end of INAc (5-end in this paper), the

new transposants could be recorded for insertion-tagged

sequence libraries for rice.

All the features described above indicate that the

inducible transposon system would be a valuable tool

for Agro-biotechnology, e.g. either to create knockout

mutants or to generate selectable marker-free transgenic

plants. Nevertheless, several improvements must be

considered in order to design a new inducible transposon

for plant gene tagging systems. First, the fact that INAc

can transpose spontaneously in tomato, tobacco, and

rice indicates that the PR-1a inducible promoter can

be activated by endogenous stimuli in these plants.

Although the expression level in this condition might

be low, the resulting abundance of the transposase is

likely sufficient to drive transposition events. Previous

studies indicated that Ac/ Ds transposons are easily

triggered by fewer transposases (Fusswinkel et al., 1991).

Thus, it seems that spontaneous transposition events of

CHARNG et al. ¡X The inducible transposon in rice

9

INAc may occur generally in heterologous plants, with

various efficiencies. This fact encourages us to consider

the use of an animal inducible system for constructing

new inducible transposons. Recently, several inducible

systems from animals were used in plants (Padidam

et al., 2003; Ouwerkerk et al., 2001; Zuo et al., 2000;

Bohner et al., 1999). All of these systems should be

assessed for the creation of new inducible transposon.

On the other hand, since a self-stabilizing Ac concept

has been reported (Schmitz and Theres, 1994), a one-

step inducible transposon that undergoes inducible

transposition but is stable after integration should also be

valuable. Alternatively, many activation-tagging systems

have been developed in Arabidopsis for cloning genes

(Weigel et al., 2000; Marsch-Martinez et al., 2002). An

entrapment tagging system allows for monitoring gene

activity by creating fusions between tagged genes and

a reporter gene (Meissner et al., 2000). According to

these, several new inducible transposons based on INAc

have been demonstrated to be functional and as efficient

as INAc in rice (Charng et al., unpublished data). All of

these strategies, combined with the one-step inducible

transposon concept, will allow us to develop more efficient

transposon systems for future rice functional genomic

studies.

Acknowledgments. This project was supported by

the National Science Council (Grant No. NSC93-

2317-B-002-007-) of Taiwan.

LITERATURE CITED

Arumuganathan, K. and E.D. Earle. 1991. Nuclear DNA con-

tents of some important plant species. Plant Mol. Biol. Rep.

9: 208-218.

Beilmann, A., K. Albrecht, S. Schultz, G. Wanner, and U.M.

Pfitzner. 1992. Activation of a truncated PR-1 promoter by

endogenous enhancers in transgenic plants. Plant Mol. Biol.

18: 65-78.

Bohner, S., I. Lenk, M. Rieping, M. Herold, and C. Gatz. 1999.

Transcriptional activator TGV mediates dexamethasone-

inducible and tetracycline-inactivatable gene expression.

Plant J. 19: 87-95.

Charng, Y.C. and A.J.P. Pfitzner. 1994. The firefly luciferase

gene as a reporter for in vivo detection of Ac transposition

in tomato plants. Plant Sci. 98: 175-183.

Charng, Y.C., A.J.P. Pfitzner, U.M. Pfitzner, K.F. Charng-Chang,

C.-M. Chen, J. Tu, and T.T. Kuo. 2000. Construction of an

inducible transposon, INAc, to develop a gene tagging sys-

tem in higher plants. Mol. Breed. 6: 353-367.

Charng, Y.C., H.P. Li, H.C. Chang, K.T. Li, T.H. Hseu, and J.

Tu. 2004. Fusion of the transposase with a classical nuclear

localization signal to increase the transposition efficiency of

Ac transposon. Bot. Bull. Acad. Sin. 45: 267-274.

Chin, H.G., M.S . Choe, S.-H. Lee, S.H. P ark, S.H. Park, J.C.

Koo, N.Y. Kim, J.J. Lee, B.G. Oh, G.H. Yi, S.C. Kim, H.C.

Choi, M.J. Cho, and C.-D. Han. 1999. Molecular analysis

of rice plants harboring an Ac/Ds transposable element-

mediated gene trapping system. Plant J. 19: 615-623.

David, C.C. 1991. The world rice economy: challenges ahead, in

Rice Biotechnology. Edited by Khush GS, Toenniessen GA

International Rice Research Institute, pp. 1-18.

De Wet, J.R., K.V. Wood, M. DeLuca, D.R. Helinski, and S.

Subramani. 1987. Firefly luciferase gene: structure and

expression in mammalian cells. Mol. Cell Biol. 7: 725-737.

E noki, H., T. Iz awa, M. Kawa hara, M. Kom ats u, S. Koh,

J. Kyozuka, and K. S himam oto. 1999. Ac as a tool for

functional genomics of rice. Plant J. 19: 605-613.

F us swinkel, H., S . S hein, U. Courage, P. Starlinger, and R.

Kunze . 1991. Dete ction and a bundance of mRNA and

protein encoded by transposable element Activator (Ac) in

maize. Mol. Gen. Genet. 225: 186-192.

Greco, R., P.B.F. Ouwe rkerk, C. S allaud, A. Kohli, and L.

Colombo. 2001a. Transposon insertional mutagenesis in

rice. Plant Physiol. 125: 1175-1177.

Greco, R., P.B.F. Ouwe rkerk, A.J. Taal, C. F avalli, and T.

Beguiristain. 2001b. Early and multiple Ac transposition

in rice suitable for efficient insertional mutagenesis. Plant

Mol. Biol. 46: 215-227.

Greco, R., P.B. Ouwerkerk, A.J. Taal, C. Sallaud, E. Guiderdoni,

A.H. Meijer, J.H. Hoge, and A. Pereira. 2004. Transcription

and somatic transposition of the maize En/Spm transposon

system in rice. Mol. Genet. Genomics 270: 514-23.

Harushima, Y., M.Yano, A. Shomura, M. Sato, T. Shimano, Y.

Kuboki, T. Yamamoto, S.Y. Lin, B.A. Antonio, A. Parco, H.

Kajiya, N. Huang, K. Yamamoto, Y. Nagamura, N. Kurata,

G.S. Khush, and T. S asa ki. 1998. A hi gh-dens ity rice

genetic linkage map with 2275 markers using a single F2

population. Genetics 148: 479-494.

Hiei, Y., S. Ohta, T. Komari, and T. Kumashiro. 1994. Efficient

trans format ion of ri ce (Ory za s ativa L .) m edia ted by

Agrobacterium and sequence analysis of the boundaries of

the T-DNA. Plant J. 6: 271-282.

Hirochika, H. 2001. Contribution of the Tos17 retrotransposon

to ric e functional genomics. Curr. Opin. Plant Biol. 4:

118-122.

Hirochika, H., E. Guiderdoni, G. An, Y.I. Hsing, M.Y. Eun,

C.D. Han, N. Upadhyaya, S. Ramachandran, Q. Zhang, A.

Pereira, V. Sundaresan, and H. Leung. 2004. Rice mutant

resources for gene discovery. Plant Mol. Biol. 54: 325-34.

Iz awa, T., C. Miyaza ki, M. Yama moto, R. Te rada, and S .

Iida. 1991. Introduction and transposition of the m aize

transposable element Ac in rice (Oryza sativa L.). Mol.

Gen. Genet. 227: 391-396.

Izawa, T., T. Ohnishi, T. Nakano, N. Ishida, and H. Enoki. 1997.

Transposon tagging in rice. Plant Mol. Biol. 35: 219-229.

Jeon, J. and G. An. 2001. Gene tagging in rice: a high throughput

system for functional genomics. Plant Sci. 161: 211-219.

Karlys hev, A.V., M.J. Pallen, and B.W. Wren. 2000. Single-

primer PCR procedure for rapid identification of transposon

insertion sites. Biotechniques 28: 1078, 1080, 1082.

10

Botanical Studies, Vol. 48, 2007

Komats u, M., A. Chujo, Y. Nagato, K. S himam oto, a nd J .

Kyozuka. 2003. FRIZZY PANICLE is required to prevent

the formation of axillary meristems and to establish floral

meristem identity in rice spikelets. Development 130:

3841-3850.

Kumar, C.S ., R.A. Wing, and V. Sundaresan. 2005. Efficient

insertional mutagenesis in rice us ing the maize En/S pm

elements. Plant J. 44: 879-92.

Liu, Y.G., N. Mitsukawa, T. Oosumi, and R.F. Whittier. 1995.

Efficient isolation and mapping of Arabidopsis thaliana

T-DNA insert junctions by thermal asymmetric interlaced

PCR. Plant J. 8: 457-463.

Marsch-Martinez, N., R. Greco, G. Van Arkel, L. He rrera-

Estrella, and A. P ereira. 2002. Activation tagging us ing

the En-I maize transposon sys tem in Arabidopsis. Plant

Physiol. 129(4): 1544-1556.

Meissner, R, V. Chague, Q. Zhu, E. Emmanuel, Y. Elkind, and

A. Levy. 2000. A high throughput system for transposon

tagging and promoter trapping in tomato. P lant J. 22:

265-274.

Muller-Neumann, M., J.I. Yoder, and P. Starlinger. 1984. The

DNA sequence of the transposable element of Ac of Zea

mays L. Mol. Gen. Genet. 198: 19-24.

Nakagawa , Y., C. Machida, Y. Machida, and K. Toriya ma.

2000. Frequency and pattern of transposition of the maize

transposable element Ds in transgenic rice plants. Plant Cell

Physiol. 41: 733-742.

Ouwerkerk, P., R.J . de Kam, J .H.C. Hoge, and A.H. Meijer.

2001. Glucocorticoid-inducible gene expres sion in rice.

Planta 213: 370-378.

Padidam, M., M. Gore, L. Lu, and O. Smirnova. 2003.

Che m ic al -ind uci ble , e cdy so ne r ec ept or-ba s ed g ene

expression system for plants. Transgenic Res. 12: 101-109.

Sakata, K., B.A. Antonio, Y. Mukai, H. Nagasaki, Y. Sakai, K.

Makino, and T. Sasaki. 2000. INE: a rice genome data-

base with an integrated map view. Nucleic Acids Res. 28:

97-101.

Schmitz, G. and K. Theres. 1994. A self-stabilizing Ac derivative

and its potential for transposon tagging. Plant J. 6: 781-786.

Shimamoto, K., C. Miyazaki, H. Hashimoto, T. Izawa, K. Itoh,

R. Terada, Y. Inagaki, and S. Iida. 1993. Trans-activation

and stable integration of the maize transposable element Ds

cotransfected with the Ac transposase gene in transgenic

rice plants. Mol. Gen. Genet. 239: 354-360.

Temnykh, S., W.D. Park, N. Ayres, S. Cartinhour, N. Hauck,

L. Lipovich, Y.G. Cho, T. Ishii, and S.R. McCouch. 2000.

Ma pping a nd gen ome org aniz at ion of m icro sa tel lit e

sequences in rice (Oryz a sativa L.). Theor. Appl. Genet.

100: 697-712.

Toki, S. 1997. Rapid and efficient Agrobacterium-mediated

transformation in rice. Plant Mol. Biol. Rep. 15: 16-21.

Tyagi, A.K. and A. Mohanty. 2000. Rice transformation for crop

improvement and functional genom ics. Plant Sci. 158:

1-18.

Velten, J., L. Velten, R. Hain, and J. Shell. 1984. Isolation of

a dual plant prom oter fragment from the Ti plas mid of

Agrobacterium tumefaciens. EMBO J. 3: 2723-2730.

Weigel, D., J .H. Ahn, M.A. Bl azquez, J.O. Borevitz, S .K.

Christensen, C. F ankhauser, C. F errandiz, I. Kardailsky,

E.J. Malancharuvil, M.M. Neff, J.T. Nguyen, S. Sato, Z.-Y.

Wang, Y. Xia , R.A. Dixon, M.J. Harrison, C.J . Lamb,

M.F. Yanofsky, and J. Chory. 2000. Activation tagging in

Arabidopsis. Plant Physiol. 122: 1003-1013.

Yuan, Q., F. L iang, J. Hsiao, V. Zis mann, M.-I. Benito, J.

Quackenbush, R. Wing, and R. Buell. 2000. Anchoring of

rice BAC clones to the rice genetic map in silico. Nucleic

Acids Res. 28: 3636-3641.

Zuo, J., Q.W. Niu, and N.H. Chua. 2000. An estrogen receptor-

based transactivator XVE mediates highly inducible gene

expression in transgenic plants. Plant J. 24: 265-273.

Zhu, Q.H., M.S . Hoque, E.S . Dennis , and N.M. Upadhyaya.

2003. Ds tagging of BRANCHED FLORETLESS 1 (BFL1)

that mediates the transition from spikelet to floret meristem

in rice (Oryza sativa L.). BMC Plant Biol. 3: 6.

Zhu, Q.H., K. Ramm, R. Shivakkumar, E.S. Dennis, and N.M.

Upadhyaya. 2004. The ANTHER INDEHISCENCE1 gene

encoding a single MYB domain protein is involved in

anther development in rice. Plant Physiol. 135: 1514-25.

CHARNG et al. ¡X The inducible transposon in rice

11