Botanical Studies (2008) 49: 109-117.
*
Corresponding author: E-mail: boyhlin@gate.sinica.edu.
tw, Phone: 886-2-27899590 ext. 321, Fax: 886-2-27827954
(Yaw-Huei LIN); E-mail: hjchen@faculty.nsysu.edu.tw
(Hsien-Jung CHEN).
BiochemiStry
expression of sweet potato asparaginyl endopeptidase
caused altered phenotypic characteristics in transgenic
Arabidopsis
Hsien-Jung CHEN
1,
*, I-Chia WEN
1
, Guan-Jhong HUANG
2
, Wen-Chi HOU
3
, and Yaw-Huei LIN
4,
*
1
Department of Biological Sciences, National Sun Yat-sen University, 804 Kaohsiung, Taiwan
2
Graduate Institute of Chinese Pharmaceutical Sciences, China Medical University, 404 Taichung, Taiwan
3
Graduate Institute of Pharmacognosy Science, Taipei Medical University, 110 Taipei, Taiwan
4
Institute of Plant and Microbial Biology, Academia Sinica, Nankang, 115 Taipei, Taiwan
(Received August 30, 2007; Accepted November 8, 2007)
ABStrAct.
We have previously isolated an asparaginyl endopeptidase, SPAE, from senescent leaves of
sweet potato (Ipomoea batatas cv. Tainong 57). Gene expression of SPAE was activated and enhanced in
natural and induced senescent leaves (Chen et al., 2004). In this report the full-length SPAE cDNA was
constructed in the T-DNA portion of recombinant pBI121 vector under the control of CaMV 35S promoter
and transferred to Arabidopsis with Agrobacterium-mediated floral dip transformation. Three transgenic
Arabidopsis plants were isolated and confirmed by kanamycin-resistance and genomic PCR amplification
of SPAE. Protein gel blot also demonstrated sweet potato SPAE expression in these transgenic plants.
Phenotypic analysis showed that transgenic plants exhibited earlier floral transition from vegetative growth
and leaf senescence than control. Transgenic plants also contained fewer siliques and a higher percentage of
incompletely-developed siliques per plant than control. Based on these results we conclude that sweet potato
asparaginyl endopeptidase, SPAE, may function in association with the senescence process, and its expression
enhances or promotes senescence in transgenic Arabidopsis plants. The altered phenotypic characteristics in
transgenic plants with SPAE gene expression were also discussed.
Keywords: Asparaginyl endopeptidase; Silique; SPAE; Sweet potato; Transgenic Arabidopsis.
iNtroDUctioN
Leaf senescence has been considered as a type of
programmed cell death and is the final stage of leaf
development. Senescence is not simply a degenerative
process, but also a recycling one, in which nutrients are
translocated from the senescent cells to young leaves,
developing seeds, or storage tissues (Buchanan-Wollaston,
1997; Quirino et al., 2000). Leaf cells undergo highly
coordinated changes in structure, metabolism, and gene
expression in a defined order during senescence. The
earliest and most significant change in cell structure
is the breakdown of the chloroplast (Makino and
Osmond, 1991). Metabolically, the carbon assimilation
(photosynthesis) is replaced by a catabolism of
macromolecules and organelles which leads to the final
cell death. During leaf senescence, breakdown of leaf
proteins by proteases provides a large pool of cellular
nitrogen for recycling (Makino and Osmond, 1991).
In plants, three major degradation pathways have been
described: (a) the ubiquitin-dependent pathway, (b) the
chloroplast degradation pathway, and (c) the vacuolar
degradation pathways (Vierstra, 1996). Among these
pathways, vacuolar degradation is assumed to be involved
in bulk protein degradation by virtue of the resident
proteinases in the vacuole. Two types of vacuoles have
been described in plants: (a) the storage vacuole and (b)
the lytic central vacuole (Marty, 1999). Protein storage
vacuoles are often found in seed tissues and accumulate
proteins that are re-mobilized and used as the main nutrient
resource for germination (Senyuk et al., 1998; Schlereth et
al., 2001).
Most cells in vegetative tissues have a large central
vacuole, containing a wide range of proteases in an acidic
environment. Substrate proteins must be transported and
sequestered into this vacuole for degradation. The role
and function of vacuolar processing enzymes (VPEs)
in association with vacuolar protein degradation and
the nutrient recycling pathway in senescent leaves are
generally not clear. Recently a novel group of plant VPEs
was found in the developing seeds of the castor bean
pg_0002
110
Botanical Studies, Vol. 49, 2008
(Hara-Nishimura et al., 1991) and soybean (Scott et al.,
1992; Hara-Nishimura et al., 1995), from mature seeds
of the jack bean (Abe et al., 1993), and from germinating
seeds of vetch (Becker et al., 1995). In castor bean and
soybean seeds, VPEs were detected in the protein bodies
and likely associated with the conversion of proproteins
to their corresponding mature forms in vacuoles (Hara-
Nishimura et al., 1991; Shimada et al., 1994; Shimada et
al., 2003). VPEs also play a role in bulk degradation and
mobilization of storage proteins during seed germination
and seedling growth. An asparaginyl-specific cysteine
endopeptidase, called "legumain-like proteinase" (LLP),
was isolated from cotyledons of kidney bean (Phaseolus
vulgaris) seedlings. It was the first proteinase ever known
to extensively degrade native phaseolin in vitro, the major
storage globulin of this grain legume (Senyuk et al., 1998).
In vetch (Vicia sativa) seeds, the legumain-like VsPB2 and
proteinase B together with additional papain-like cysteine
proteinases were responsible for the bulk breakdown and
mobilization of storage globulins during seed germination
(Schlereth et al., 2000). In Arabidopsis, the seed protein
profiles were compared between the wild type and a seed-
type vacuolar processing enzyme ]VPE mutant using
a two dimensional gel/mass spectrometric analysis. A
significant increase in accumulation of several legumin-
type globulin propolypeptides was found in ]VPE mutant
seeds (Gruis et al., 2002). In sweet potato, an aspartic type
protease was reported to degrade trypsin inhibitors, the
major storage proteins (Hou et al., 2002).
The mechanism of VPE associated with bulk storage
protein degradation in seed has been studied in Vigna
mungo. A vacuolar cysteine proteinase, designated SH-
EP, is synthesized in cotyledons of germinated Vigna
mungo seeds and is responsible for degradation of seed
proteins accumulated in protein bodies (protein storage
vacuoles). SH-EP belongs to the papain proteinase
family and has N-terminal and a C-terminal prosegments
(Okamoto and Minamikawa, 1999; Okamoto et al., 1999).
Okamoto and Minamikawa (1995) isolated a processing
enzyme, designating it VmPE-1. It is a member of the
VPEs and is involved in the post-translational processing
of SH-EP. In addition, the cleavage sites of the in vitro
processed intermediates and the mature form of SH-EP
were identical to those of SH-EP purified from germinated
cotyledons of V. mungo. Therefore, it is proposed that the
VPE (VmPE-1)-mediated processing mainly functions
in the activation of proSH-EP during seed germination
(Okamoto et al., 1999). The activated SH-EP plays a
major role in the degradation of seed storage proteins
accumulated in cotyledonary vacuoles of Vigna mungo
seedlings (Mitsuhashi et al., 1986).
We previously isolated a full-length cDNA of
asparaginyl endopeptidase SPAE from sweet potato
senescent leaves which exhibited high amino acid
sequence homologies to plant VPEs, including kidney
bean (Phaseolus vulgaris), spring vetch (Vicia sativa),
and jack bean (Canavalia ensiformis) (Chen et al., 2004).
Gene expression of SPAE was significantly enhanced in
both natural and induced senescent leaves (Chen et al.,
2004). In this report the full-length cDNA of SPAE was
constructed in the T-DNA portion of recombinant pBI121
vector under the control of CaMV 35S promoter and
transferred into Arabidopsis plants by Agrobacterium-
mediated floral dip transformation. Expression of sweet
potao SPAE in transgenic Arabidopsis plants and its
association with altered phenotypic characteristics were
investigated and discussed.
mAteriALS AND methoDS
Plant materials and sweet potato SPAE
The storage roots of sweet potato (Ipomoea batatas
cv. Tainong 57) were grown in the greenhouse. Plantlets
regenerated from the storage roots were used for
experiments. Arabidopsis thaliana ecotype Columbia was
the plant material for transgenic studies. The full-length
cDNA of the sweet potato senescence-associated gene
SPAE (GenBank accession no. AF260827), which encodes
an asparaginyl endopeptidase (also known as a vacuolar
processing enzyme), was constructed in the T-DNA
portion of the pBI121 vector (Clontech) and used for
the Agrobacterium-mediated floral dip transformation of
Arabidopsis (Clough and Bent, 1998). Polyclonal antibody
previously produced against sweet potato SPAE was used
for protein gel blot hybridization (Chen et al., 2004).
Agrobacterium-mediated floral dip
transformation of Arabidopsis
The full-length SPAE cDNA in recombinant
pGEM-T easy vector was amplified with the following
5 and 3 primers containing an introduced SmaI
(CCCGGG) restriction enzyme cutting site. The
primer pair for SPAE (5 primer: ATCGCCCGGG
ATGATTCGCTCCGTCGTCGC and 3 primer:
ATCGCCCGGGTTATGCACTGAA TCCTCCTC)
was used to amplify the full-length SPAE cDNA. After
amplification the PCR products were first cloned into
the pGEM-T easy vector (Promega), then released with
restriction enzyme SmaI and subcloned into the T-DNA
portion of pBI121 vector, which was digested with the
same restriction enzyme (Figure 1). Both recombinant
pGEM-T easy and pBI121 vectors were transformed into
and replicated in E. coli DH5\ cells. The correctness of
these constructs in recombinant pGEM-T easy and pBI121
vectors was also confirmed by DNA sequencing using an
ABI PRIZM 337 DNA sequencer. After confirmation, the
correct recombinant pBI121 vector was transferred into
Agrobacterium tumefaciens LBA4404 competent cells
(Clonetech), with electroporation following the protocol
supplied by the manufacturer (BIO-RAD). Transformed
Agrobacterium tumefaciens cells were confirmed by PCR
amplification using gene-specific primers as described
earlier and utilized for Arabidopsis transformation with
the floral dip method (Clough and Bent, 1998). After
transformation, the Arabidopsis plant continued to grow
pg_0003
CHEN et al. X Sweet potato asparaginyl endopeptidase
111
Figure 1. Cons truction of a full-
length cDNA of sweet potato SPAE
in T-DNA of recombinant pBI121
ve ctor. A, T he ful l-length cDNA
s equ ence of s weet potato SPAE;
B, Construction of the full-length
cDNA (from ATG initiation codon
to TAA stop codon) of sweet potato
SPAE within the T-DNA portion
of pBI121 vector. The upper is the
uncons tructed T-DNA portion of
pBI121 (pBI121). The lower is the
r ec om bin ant T-D NA por ti on of
rec om binant pBI121 (YP ) which
c ontains sweet potato SPAE full-
length cDNA under the control of
CaMV 35S promoter. X: XmaI;
S : Sma I; AT G: s tart codon; Kan
R: Kanamycin-resistance gene
a s a s e le c t a b l e m a rk e r ; GU S :
]-Glucuronidase; RB: right border
o f T-DN A; L B : l e ft bo rd e r of
T-DNA.
until seed set. These seeds were assigned as T0 seeds
and collected for screening of transgenic T0 Arabidopsis
seedlings.
identification and characterization of transgenic
Arsbidopsis plants
Transgenic T0 seedlings were identified and isolated
after seed germination on half-strength MS salt medium
with 1% sucrose, 500 gg/mL cefotaxine, and 50 gg/mL
kanamycin under a regime of 22XC day/18XC night, 16
h light/8 h dark. The seedlings with a green phenotype
were identified as putative transgenic T0 plants. These
plants were then transferred to soil and grown in the
growth chamber until flowering and T1 seed set. T1 seeds
were collected and germinated on half-strength MS salt
medium with 1% sucrose, 500 gg/mL cefotaxine, and 50
gg/mL kanamycin under the same light/dark regime. The
T1 seedlings with a green phenotype were identified as
putative transgenic plants and used for characterization as
described below.
Genomic Pcr amplification of SPAE
Putative transgenic T1 seedlings with a green
phenotype grown on kanamycin-containing medium for
2 to 3 weeks after germination were transferred to soil
and grown in a growth chamber under regime of 22XC
day/18XC night, 16 h light/8 h dark. Leaf tissues of these
putative transgenic T1 plants were collected for genomic
PCR. About 0.5 g of putative transgenic T1 Arabidopsis
and control plant samples were collected individually for
genomic DNA isolation with the CTAB method (Chen
et al., 2004). The same amount of purified genomic
DNAs isolated from control and putative transgenic
plants were used for PCR amplification with the primer
pair (5 primer: ATGATTCGCTCCGTCGTCGC and 3
primer: TTATGCACTGAA TCCTCCTC) to confirm the
presence of full-length SPAE cDNA in putative transgenic
Arabidopsis plants (Jonson et al., 2000).
pg_0004
112
Botanical Studies, Vol. 49, 2008
Protein gel blot hybridization
Putative transgenic T1 seedlings with a green
phenotype grown on kanamycin-containing medium for
2 to 3 weeks after germination were transferred to soil
and grown in a growth chamber under a regime of 22XC
day/18XC night, 16 h light/8 h dark. Leaf tissues of these
putative transgenic T1 plants were collected for protein gel
blot hybridization. About 0.3 g samples of transgenic T1
Arabidopsis and control plants were collected individually
for total protein isolation, and ca. 100 gg total protein of
each sample was used for protein gel blot hybridization
with the polyclonal antibodiy against SPAE protein (Chen
et al., 2004).
Analysis of morphological characteristics
Several phenotypic characters were observed and
qualitatively or quantitatively compared between control
and transgenic T1 plants. These characters included the
time of transition from vegetative to reproductive growth,
senescence of leaf, the silique and seed development, the
number of seeds per silique, and the number of siliques per
plant. Seedlings of transgenic T1 and control plants were
grown under the same environmental conditions (22XC
day/18XC night, 16 h light/8 h dark) in a growth chamber.
The transition from vegetative phase to reproductive
phase was compared and recorded once the inflorescence
and flower had set. After flowering, the silique and seed
development were also examined. Arabidopsis siliques
were arbitrarily classified into four types (1 to 4) according
to their morphologies after maturation. The morphology of
different silique types, the number of seeds per silique of
different types, and the percentage of incomplete silique
development were compared and recorded among control
and transgenic T1 plants.
reSULtS
Sweet potato SPAE gene is identified and
expressed in transgenic Arabidopsis plants
In order to study the possible function of sweet ptato
SPAE, its full-length cDNA was constructed in the T-DNA
portion of pBI121 vector and transferred into Arabidopsis
plants with the Agrobacterium-mediated floral dip
transformation method. Transgenic Arabidopsis plants
were isolated and identified using kanamycin resistance
and genomic PCR amplification of SPAE full-length
cDNA. In this experiment ca. 1 out of 5,000 to 10,000
seeds screened was identified as putative transgenic.
Therefore, the transformation frequency was about 0.1%
to 0.2%. Three putative transgenic T0 seedlings with green
phenotype were isolated and designated YP1, YP2, and
YP3. These putative transgenic plants were transferred to
soil and grew until flowering and T1 seed had set. These
T1 seeds were germinated on kanamycin-containing MS
medium, and seedlings with green and white phenotypes
were observed due to the meiotic segregation of the insert
gene. Kanamycin-resistant T1 seedlings from YP1, YP2
and YP3 were identified as transgenic and utilized for
further characterization.
Figure 2 shows the PCR products from genomic
DNAs isolated from transgenic T1 seedlings and
nontransformant control. The PCR products amplified
with primers for SPAE full-length cDNA were detected
and had molecular masses between 1.5 kb and 2.0 kb for
all transgenic T1 seedlings of YP1, YP2 and YP3, but
not for nontransformant control. These data demonstrate
the presence of sweet potato SPAE gene in transgenic T1
seedlings. Protein gel blot hybridization with polyclonal
antibody raised against SPAE (Chen et al., 2004) showed
that a band with a molecular mass between 34 kDa and
40 kDa was detected from samples of sweet potato S1
senescent leaves and transgenic T1 Arabidopsis seedlings,
but not from samples of sweet potato S0 mature young
leaves and nontransformant Arabidopsis control (Figure
3). An extra band with a molecular mass between 40 kDa
and 55 kDa was also detected from samples of transgenic
T1 Arabidopsis plants, but not from samples of sweet
potato S0/S1 mature young leaves and nontransformant
Arabidopsis control (Figure 3). The reason is not clear.
However, one of the possible explanation is that the
extra band with higher molecular mass than the predicted
mature form of SPAE protein may be due to the incomplete
or lower processing efficiency of sweet potato SPAE
precursor in transgenic T1 Arabidopsis plants than in
sweet potato S1 senescent leaves. These data demonstrate
that sweet potato SPAE can be expressed and processed
into a mature form of SPAE protein in transgenic T1
Arabidopsis plants.
Figure 2. Genomic PCR analys is of putative transgenic T1
Arabidopsis plants. Total genomic DNA from nontransformant
control and three isolated transgenic T1 Arabidopsis plants
(YP1, YP2 and YP3) were analyzed for the presence of sweet
potato SPAE gene. C and YP1/YP2/YP3 denote nontransformant
control and transgenic Arabidopsis plants, respectively. M
represents the molecular weight marker.
pg_0005
CHEN et al. X Sweet potato asparaginyl endopeptidase
113
transgenic t1 Arabidopsis plants exhibited
earlier flowering and leaf yellowing
In order to characterize the effects of sweet potato
SPAE gene expression on the phenotypic properties of
Arabidopsis transgenic plants, the growth patterns were
compared and recorded among nontransformant control
and transgenic T1 Arabidopsis plants. Transgenic T1
Arabidopsis plants expressing SPAE exhibited earlier floral
transition from vegetative growth than nontransformant
control ca. 30 to 35 days after seed germination
(Figure 4A). Early flowering is generally considered
a phenomenon of senescence. During seed and silique
development, the lower leaves of Arabidopsis plants
began to senesce, and a higher degree of leaf yellowing
was observed for transgenic T1 Arabidopsis plants than
for nontransformant control plants around 7 weeks
after seed germination (Figure 4B). These data support
the conclusion that sweet potato SPAE is a senescence-
associated gene and its expression likely enhances or
promotes senescence in transgenic Arabidopsis plant.
transgenic t1 Arabidopsis plants contained
higher percentage of incompletely-developed
siliques and fewer siliques per plant
The phenotypic effects of sweet potat SPAE gene
expression on the silique and seed development of
transgenic T1 Arabidopsis plants were also investigated
and recorded. First of all, four types of siliques were
classified according to their morphologies and seed
numbers per silique. Type 1 silique exhibited a fully-
developed morphology (Figure 5A and 5B) with ca. 55
seeds per silique (Figure 6A). Type 2 silique displayed
a slightly shorter and thinner morphology (Figure 5A
and 5C) with ca. 32 seeds per silique (Figure 6A). Type
F igu re 3. P rot ein gel blot hybridiza tion of trans genic T 1
Arabidopsis plants with rabbit polyclona l antibody agains t
sweet potato SPAE protein. S0 and S 1 represent sweet potato
m at ure yo ung an d se nes c ing le ave s wi th 10 0% and 25%
chlorophyll contents, respectively. C and YP1/YP2/YP3 denote
nontransformant control and trans genic Arabidopsis plants,
respectively.
3 silique had an incompletely-developed morphology
with a size drastically reduced to about one-half of the
type 1 silique (Figure 5A and 5D) and ca. 20 seeds per
silique (Figure 6A). Type 4 silique also showed a highly
underdeveloped morphology with size reduced to about
one-third of the type 1 silique (Figure 5A and 5E) and ca.
6 seeds per silique (Figure 6A). Types 2, 3 and 4 were
grouped together as the incompletely-developed siliques,
and the percentage was compared among transgenic
T1 Arabidopsis plants and nontransformant control.
Transgenic YP1 (25.43%), YP2 (23.98%), and YP3
(31.40%) plants contained much higher incompletely
developed silique percentages than control (2.19%) (Figure
6B). In addition, transgenic YP1 (57), YP2 (78) and YP3
(57) had significantly fewer siliques per plant than control
(99) (Figure 7). The percentages of silique numbers per
plant of T1 transgenic Arabidopsis were about 60 to 80%
that of control. These data demonstrate that SPAE gene
expression may influence seed and silique development
and result in reduced seed number per silique, smaller
silique numbers per plant, and a higher percentage of
incompletely developed siliques per plant in transgenic
Arabidopsis plants.
DiScUSSioN
In this report, three transgenic Arabidopsis plants were
isolated and identified with the floret dip transformation
method (Clough and Bent, 1998). Genomic PCR and
protein gel blot analysis confirmed that these Arabidopsis
plants (YP1, YP2 and YP3) were transgenic and contained
the foreign sweet potato SPAE gene in their genomes
(Figure 2), which can be expressed as mature protein
products (Figure 3). Two bands were detected in transgenic
T1 Arabidopsis plants. The lower band, with molecular
mass between 34 kDa and 40 kDa, has a band position
similar to that of the positive control from sweet potato
S1 senescent leaves. The putative mature form of SPAE
after removal of N-terminal and C-terminal prosegments
contains 325 amino acids and has a predicted molecular
mass ca. 36 kDa (Chen et al., 2004). Therefore, the lower
band likely represents the mature form of SPAE. The upper
band with molecular mass between 40 kDa and 55 kDa
was close to the predicted molecular mass of the putative
intermediate form of SPAE, which contained 442 amino
acids after removal of N-terminal prosegment and had a
predicted molecular mass ca. 49 kDa. Therefore, the upper
band likely represents the intermediate form of SPAE.
Similar results have also been observed and reported for
various plant vacuolar processing enzymes, including
Vigna mungo VmPE-1 (Okamoto et al., 1999), Arabidopsis
]VPE (Gruis et al., 2002), Arabidopsis ^VPE (Kuroyanagi
et al., 2002; Rojo et al., 2003). These data also support the
conclusion that transgenic Arabidopsis plants may contain
similar processing mechanisms for correcting sweet potato
SPAE processing and thus can produce mature sweet
potato SPAE protein products.
pg_0006
114
Botanical Studies, Vol. 49, 2008
Transgenic Arabidopsis plants exhibited an earlier floral
transition from vegetative growth and leaf senescence
(Figure 4). Early transition from a vegetative phase to
the reproductive phase has been reported as a type of
senescence. The reasons and mechanisms that allow
sweet potato SPAE gene expression to promote earlier
floral transition and enhance senescence in transgenic
Arabidopsis plants are not clear. However, Raper et al.
(1988) and Rideout et al. (1992) hypothesized that floral
transition is stimulated by an imbalance in the relative
availability of carbohydrate and nitrogen in the shoot
apical meristem. Therefore, whether SPAE expression can
interfere with the endogenous metabolic balance, which
in turn leads to accelerated senescence, awaits further
investigation.
Expression of sweet potato SPAE in transgenic
Arabidopsis plants caused reduced seed number per
silique, an elevated number of incompletely-developed
silique, and smaller silique numbers per plant (Figures
5, 6 and 7). The reasons for the altered phenotypic
characteristics in transgenic Arabidopsis by sweet potato
SPAE expression are not clear. However, sweet potato
SPAE is in close association with the plant vacuolar
processing enzymes of seeds from phylogenic analysis
(Chen et al., 2004). These enzymes have been implicated
in the degradation and mobilisation of the storage proteins
called globulins during seed germination and seedling
growth in Phaseolus vulgaris (Senyuk et al., 1998), Vigna
mungo (Okamoto et al., 1999), Vicia sativa (Schlereth et
al., 2000; Schlereth et al., 2001), and Arabidopsis thaliana
(Gruis et al., 2002). In Vigna mungo, VmPE-1 has been
demonstrated to increase in the cotyledons of germinating
seeds and was involved in the post-translational processing
of a vacuolar cysteine endopeptidase, designated SH-
EP, which degraded seed storage proteins (Okamoto and
Minamikawa, 1999). Whether it is inappropriate pre-
degradation of globulin-type storage protein during seed
development and maturation by constitutively expressed
sweet potato SPAE in transgenic Arabidopsis that results
in partial repression of seed and silique development and
in turn lead to a higher incompletely-developed silique
percentage (Figures 5 and 6) and lower silique numbers
Figure 4. C om p a ri s o n o f gr o w t h p a t t e rn s b e t w e e n
nontransformant control and transgenic T1 Arabidopsis plants,
YP3. A, Floral transition from vegetative growth was observed
at ca. 30 to 35 days after seed germination; B, Leaf senescence
during seed and silique development was recorded at ca. 6 to 7
weeks after seed germination.
Figure 5. Cl as s i fic at ion of s i li que s ac co rdi ng t o t hei r
morphology. A, There are four types of siliques (types 1, 2, 3
and 4) classified; B, Dissection of type 1 silique; C, Dissection
of type 2 silique; D, Dissection of type 3 silique; E, Dissection
of type 4 silique.
pg_0007
CHEN et al. X Sweet potato asparaginyl endopeptidase
115
per plant (Figure 7) awaits further investigation. Based on
these results we conclude that sweet potato asparaginyl
endopeptidase, SPAE, may function in association with
the senescence process, and its expression enhances or
promotes senescence in transgenic Arabidopsis plants.
Acknowledgment. The authors thank the financial
support (NSC93-2313-B-034-002 and NSC95-2313-
B-034-003-MY2) from the National Science Council,
Taiwan, ROC.
LiterAtUre citeD
Abe, Y., K. Shirane, H. Yokosawa, H. Matsushita, M. Mitta, I.
Kato, and S . Ishii. 1993. Asparaginyl endopeptidases of
jack bean seeds. J. Biol. Chem. 268: 3523-3529.
Becker, C, A. D., V. H. S hut ov, V. I. Nong, R. S enyuk, C.
Jung, J. Horstmann, N. Fischer, C. Nielsen, and K. Muntz.
1995. P urific ation, cDNA cloning and c haracterization
o f prote ina s e B, a n as pa ragi nyl e ndope pti das e from
germinating vetch (Vicia satava L.) seeds. Eur. J. Biochem.
228: 456-462.
Buchanan-Wollas ton, V. 1997. The molecular biology of leaf
senescence. J. Exp. Bot. 48: 181-199.
Chen, H.J., W.C. Hou, J .S. Liu, C.Y. Yang, D.J. Huang, and
Y.H. Lin. 2004. Molecular cloning and characterization of
a cDNA encoding asparaginyl endopeptidase from sweet
potato (Ipomoea batatas (L.) Lam) senescent leaves. J. Exp.
Bot. 55: 825-835.
Clough, S.J. and A.F. Bent. 1998. Floral dip: a simplified method
for Agrobacterium-mediated transformation of Arabidopsis
thaliana. Plant J. 16: 735-743.
Gruis, D.F., D.A. Selinger, J.M. Curran, and R. Jung. 2002.
Redundant proteolytic mechanis ms process seed storage
p rotei ns i n the a bse nce of se ed-ty pe me mbe rs of the
vacuolar processing enzyme family of cysteine proteases.
Plant Cell 14: 2863-2882.
Hara-Nishimura, I., K. Inoue, and M. Nishimura. 1991. A unique
vacuolar processing enzyme responsible for conversion of
several proprotein precursors into the mature forms. FEBS
Lett. 294: 89-93.
Hara-Nishimura, I., T. Shimada, N. Hiraiwa, and M. Nishimura.
1 995 . Va c uol ar pro ce s s ing en zy me re s po ns ib le for
maturation of seed proteins. J. Plant Physiol. 145: 632-640.
Hou, W.C., D.J. Huang, and Y.H. Lin. 2002. An aspartic type
prote ase degrades trypsin inhibitors , the major s torage
proteins of sweet potato Ipomoea batatas (L .) Lam cv.
Tainong 57. Bot. Bull. Acad. Sin. 43: 271-276.
Jons on, T., E. H. Mahla ma ki, R. Karhu, L. Gorunova, B.
J ohanss on, and M. Huglund. 2000. Characterization of
genomically amplified segments us ing PCR: Optimizing
relative-PCR for reliable and simple gene expression and
gene copy analyses . Genes Chromosomes Cancer 29:
192-199.
Kuroyanagi, M., M. Nishimura, and I. Hara-Nishimura. 2002.
F igu re 6. Com paris on of see d numbe r pe r sil ique am ong
diffe rent s ilique type s and incompletely-developed s ilique
pe rce ntage betwe en cont rol and t rans geni c T1 pl ants . A,
Comparison of seed number per silique among different silique
t ypes ; B, Com paris on of inc omple tel y-deve loped s ili que
percentage am ong control a nd transgenic T1 plants. C and
YP1/YP2/YP3 denote nontransformant control and transgenic
Arabidopsis plants, respectively. The data are from the average
of five plants per treatment and are shown as mean SE.
F igure 7. Com parison of si lique number per plant a mong
control and transgenic T1 plants. C and YP1/YP2/YP3 denote
nontransformant control and trans genic Arabidopsis plants,
respectively. The data are from the average of five plants per
treatment and are shown as mean SE.
pg_0008
116
Botanical Studies, Vol. 49, 2008
Activation of Arabidopsis vacuolar processing enzyme by
self-catalytic removal of an auto-inhibitory domain of the
C-terminal propeptide. Plant Cell Physiol. 43: 143-151.
Makino, A. and B. Osmond. 1991. Effects of nitrogen nutrition
o n n it ro ge n pa rt i ti oni ng be tw ee n c hl or opl a s ts a nd
mitochondria in pea and wheat. Plant Physiol. 96: 355-362.
Marty, F. 1999. Plant vacuoles. Plant Cell 11: 587-599.
Mitsuhashi, W., T. Koshiba, and T. Minamikawa. 1986.
S eparation and characterization of two endopeptidases
from cotyledons of germinating Vigna mungo seeds. Plant
Physiol. 80: 628-634.
Okamoto, T. and T. Minamikawa. 1999. Molecular cloning
and characterization of Vigna mungo processing enzyme 1
(VmPE-1), an asparaginyl endopeptidase possibly involved
in post-translational process ing of a vacuolar cysteine
endopeptidase (SH-EP). Plant Mol. Biol. 39: 63-73.
Okamot o, T. and T. Minam ikawa. 1995. P urifica tion of a
processing enzyme (Vm PE-1) that is involved in pos t-
translational processing of a plant cysteine endopeptidase
(SH-EP). Eur. J. Biochem. 231: 300-305.
Okamoto, T., A. Yuki, N. Mitsuhashi, and T. Mimamikawa. 1999.
Asparaginyl endopeptidase (VmP E-1) and autocatalytic
processing synergistically activate the vacuolar cysteine
proteinase (SH-EP). Eur. J. Biochem. 264: 223-232.
Quirino, B.F., Y.S. Noh, E. Himelblau, and R.M. Amasino. 2000.
Molecular aspects of leaf senescence. Trends Plant Sci. 5:
278-282.
Raper, C.D. J., J.F. Thomas, L. Tolley-Henry, and J.W. Rideout.
1988. As sess ment of an apparent relationship between
availability of soluble carbohydrates and reduced nitrogen
during floral initiation in tobacco. Bot. Gaz. 149: 289-294.
Rideout, J.W., C.D. Raper, and G.S. Miner. 1992. Changes in
ratio of soluble sugars and free amino nitrogen in the apical
meristem during floral transition of tobacco. Int. J. Plant
Sci. 153: 78-88.
Rojo, E., J. Zouhar, C. Carter, V. Kovaleva, and N. V. Raikhel.
2003. A unique mechanism for protein proces sing and
degradation in Arabidopsis thaliana. Proc. Natl. Acad. Sci.
USA 100: 7389-7394.
Schlereth, A., C. Becker, C. Horstmann, J. Tiedemann, and K.
Muntz. 2000. Comparison of globulin mobilization and
cysteine proteinas es in embryonic axes and cotyledons
during germination and seedling growth of vetch (Vicia
sativa L.). J. Exp. Bot. 51: 1423-1433.
Schlereth, A., D. Standhardt, H. P. Mock, and K. Muntz. 2001.
Stored cysteine proteinases start globulin mobilization in
protein bodies of embryonic axes and cotyledons during
vetch (Vicia s ativa L .) s eed ge rminat ion. P la nta 212:
718-727.
S cott, M.P., R. Jung, K. Muntz, and N.C. Niels en. 1992. A
protease respons ible for post-translational cleavage of a
cons erved Asn-Gly linkage in glyc inin, the major s eed
storage protein of soybean. Proc. Natl. Acad. Sci. USA 89:
658-662.
Senyuk, V., V. Rotari, C. Becker, A. Zakharov, C. Horstmann, K.
Muntz, and L. Vaintraub. 1998. Does an asparaginyl-specific
cys teine endopeptidase trigger phaseolin degradation in
cotyledons of kidney bean seedlings. Eur. J. Biochem. 258:
546-558.
Shimada, T., N. Hiraiwa, M. Nishimura, and I. Hara-Nishimura.
1994. Vacuolar processing enzyme of soybean that converts
proproteins to the corresponding mature forms. Plant Cell
Physiol. 35: 713-8.
S him ada , T., Yamada, K., and M. Kataoka. 2003. Vacuolar
processing enzymes are es sential for proper processing
of seed s torage proteins in Arabidopsis thaliana. J. Biol.
Chem. 278: 32292-32299.
Vierstra, R. D. 1996. Proteolysis in plants: mechanis ms and
functions. Plant Mol. Biol. 32: 275-302.
pg_0009
CHEN et al. X Sweet potato asparaginyl endopeptidase
117
pg_0010