Botanical Studies (2008) 49: 109-117.

*

Corresponding author: E-mail: boyhlin@gate.sinica.edu.

tw, Phone: 886-2-27899590 ext. 321, Fax: 886-2-27827954

(Yaw-Huei LIN); E-mail: hjchen@faculty.nsysu.edu.tw

(Hsien-Jung CHEN).

BiochemiStry

expression of sweet potato asparaginyl endopeptidase

caused altered phenotypic characteristics in transgenic

Arabidopsis

Hsien-Jung CHEN

1,

*, I-Chia WEN

1

, Guan-Jhong HUANG

2

, Wen-Chi HOU

3

, and Yaw-Huei LIN

4,

*

1

Department of Biological Sciences, National Sun Yat-sen University, 804 Kaohsiung, Taiwan

2

Graduate Institute of Chinese Pharmaceutical Sciences, China Medical University, 404 Taichung, Taiwan

3

Graduate Institute of Pharmacognosy Science, Taipei Medical University, 110 Taipei, Taiwan

4

Institute of Plant and Microbial Biology, Academia Sinica, Nankang, 115 Taipei, Taiwan

(Received August 30, 2007; Accepted November 8, 2007)

ABStrAct.

We have previously isolated an asparaginyl endopeptidase, SPAE, from senescent leaves of

sweet potato (Ipomoea batatas cv. Tainong 57). Gene expression of SPAE was activated and enhanced in

natural and induced senescent leaves (Chen et al., 2004). In this report the full-length SPAE cDNA was

constructed in the T-DNA portion of recombinant pBI121 vector under the control of CaMV 35S promoter

and transferred to Arabidopsis with Agrobacterium-mediated floral dip transformation. Three transgenic

Arabidopsis plants were isolated and confirmed by kanamycin-resistance and genomic PCR amplification

of SPAE. Protein gel blot also demonstrated sweet potato SPAE expression in these transgenic plants.

Phenotypic analysis showed that transgenic plants exhibited earlier floral transition from vegetative growth

and leaf senescence than control. Transgenic plants also contained fewer siliques and a higher percentage of

incompletely-developed siliques per plant than control. Based on these results we conclude that sweet potato

asparaginyl endopeptidase, SPAE, may function in association with the senescence process, and its expression

enhances or promotes senescence in transgenic Arabidopsis plants. The altered phenotypic characteristics in

transgenic plants with SPAE gene expression were also discussed.

Keywords: Asparaginyl endopeptidase; Silique; SPAE; Sweet potato; Transgenic Arabidopsis.

iNtroDUctioN

Leaf senescence has been considered as a type of

programmed cell death and is the final stage of leaf

development. Senescence is not simply a degenerative

process, but also a recycling one, in which nutrients are

translocated from the senescent cells to young leaves,

developing seeds, or storage tissues (Buchanan-Wollaston,

1997; Quirino et al., 2000). Leaf cells undergo highly

coordinated changes in structure, metabolism, and gene

expression in a defined order during senescence. The

earliest and most significant change in cell structure

is the breakdown of the chloroplast (Makino and

Osmond, 1991). Metabolically, the carbon assimilation

(photosynthesis) is replaced by a catabolism of

macromolecules and organelles which leads to the final

cell death. During leaf senescence, breakdown of leaf

proteins by proteases provides a large pool of cellular

nitrogen for recycling (Makino and Osmond, 1991).

In plants, three major degradation pathways have been

described: (a) the ubiquitin-dependent pathway, (b) the

chloroplast degradation pathway, and (c) the vacuolar

degradation pathways (Vierstra, 1996). Among these

pathways, vacuolar degradation is assumed to be involved

in bulk protein degradation by virtue of the resident

proteinases in the vacuole. Two types of vacuoles have

been described in plants: (a) the storage vacuole and (b)

the lytic central vacuole (Marty, 1999). Protein storage

vacuoles are often found in seed tissues and accumulate

proteins that are re-mobilized and used as the main nutrient

resource for germination (Senyuk et al., 1998; Schlereth et

al., 2001).

Most cells in vegetative tissues have a large central

vacuole, containing a wide range of proteases in an acidic

environment. Substrate proteins must be transported and

sequestered into this vacuole for degradation. The role

and function of vacuolar processing enzymes (VPEs)

in association with vacuolar protein degradation and

the nutrient recycling pathway in senescent leaves are

generally not clear. Recently a novel group of plant VPEs

was found in the developing seeds of the castor bean

110

Botanical Studies, Vol. 49, 2008

(Hara-Nishimura et al., 1991) and soybean (Scott et al.,

1992; Hara-Nishimura et al., 1995), from mature seeds

of the jack bean (Abe et al., 1993), and from germinating

seeds of vetch (Becker et al., 1995). In castor bean and

soybean seeds, VPEs were detected in the protein bodies

and likely associated with the conversion of proproteins

to their corresponding mature forms in vacuoles (Hara-

Nishimura et al., 1991; Shimada et al., 1994; Shimada et

al., 2003). VPEs also play a role in bulk degradation and

mobilization of storage proteins during seed germination

and seedling growth. An asparaginyl-specific cysteine

endopeptidase, called "legumain-like proteinase" (LLP),

was isolated from cotyledons of kidney bean (Phaseolus

vulgaris) seedlings. It was the first proteinase ever known

to extensively degrade native phaseolin in vitro, the major

storage globulin of this grain legume (Senyuk et al., 1998).

In vetch (Vicia sativa) seeds, the legumain-like VsPB2 and

proteinase B together with additional papain-like cysteine

proteinases were responsible for the bulk breakdown and

mobilization of storage globulins during seed germination

(Schlereth et al., 2000). In Arabidopsis, the seed protein

profiles were compared between the wild type and a seed-

type vacuolar processing enzyme £]VPE mutant using

a two dimensional gel/mass spectrometric analysis. A

significant increase in accumulation of several legumin-

type globulin propolypeptides was found in £]VPE mutant

seeds (Gruis et al., 2002). In sweet potato, an aspartic type

protease was reported to degrade trypsin inhibitors, the

major storage proteins (Hou et al., 2002).

The mechanism of VPE associated with bulk storage

protein degradation in seed has been studied in Vigna

mungo. A vacuolar cysteine proteinase, designated SH-

EP, is synthesized in cotyledons of germinated Vigna

mungo seeds and is responsible for degradation of seed

proteins accumulated in protein bodies (protein storage

vacuoles). SH-EP belongs to the papain proteinase

family and has N-terminal and a C-terminal prosegments

(Okamoto and Minamikawa, 1999; Okamoto et al., 1999).

Okamoto and Minamikawa (1995) isolated a processing

enzyme, designating it VmPE-1. It is a member of the

VPEs and is involved in the post-translational processing

of SH-EP. In addition, the cleavage sites of the in vitro

processed intermediates and the mature form of SH-EP

were identical to those of SH-EP purified from germinated

cotyledons of V. mungo. Therefore, it is proposed that the

VPE (VmPE-1)-mediated processing mainly functions

in the activation of proSH-EP during seed germination

(Okamoto et al., 1999). The activated SH-EP plays a

major role in the degradation of seed storage proteins

accumulated in cotyledonary vacuoles of Vigna mungo

seedlings (Mitsuhashi et al., 1986).

We previously isolated a full-length cDNA of

asparaginyl endopeptidase SPAE from sweet potato

senescent leaves which exhibited high amino acid

sequence homologies to plant VPEs, including kidney

bean (Phaseolus vulgaris), spring vetch (Vicia sativa),

and jack bean (Canavalia ensiformis) (Chen et al., 2004).

Gene expression of SPAE was significantly enhanced in

both natural and induced senescent leaves (Chen et al.,

2004). In this report the full-length cDNA of SPAE was

constructed in the T-DNA portion of recombinant pBI121

vector under the control of CaMV 35S promoter and

transferred into Arabidopsis plants by Agrobacterium-

mediated floral dip transformation. Expression of sweet

potao SPAE in transgenic Arabidopsis plants and its

association with altered phenotypic characteristics were

investigated and discussed.

mAteriALS AND methoDS

Plant materials and sweet potato SPAE

The storage roots of sweet potato (Ipomoea batatas

cv. Tainong 57) were grown in the greenhouse. Plantlets

regenerated from the storage roots were used for

experiments. Arabidopsis thaliana ecotype Columbia was

the plant material for transgenic studies. The full-length

cDNA of the sweet potato senescence-associated gene

SPAE (GenBank accession no. AF260827), which encodes

an asparaginyl endopeptidase (also known as a vacuolar

processing enzyme), was constructed in the T-DNA

portion of the pBI121 vector (Clontech) and used for

the Agrobacterium-mediated floral dip transformation of

Arabidopsis (Clough and Bent, 1998). Polyclonal antibody

previously produced against sweet potato SPAE was used

for protein gel blot hybridization (Chen et al., 2004).

Agrobacterium-mediated floral dip

transformation of Arabidopsis

The full-length SPAE cDNA in recombinant

pGEM-T easy vector was amplified with the following

5¡¦ and 3¡¦ primers containing an introduced SmaI

(CCCGGG) restriction enzyme cutting site. The

primer pair for SPAE (5¡¦ primer: ATCGCCCGGG

ATGATTCGCTCCGTCGTCGC and 3¡¦ primer:

ATCGCCCGGGTTATGCACTGAA TCCTCCTC)

was used to amplify the full-length SPAE cDNA. After

amplification the PCR products were first cloned into

the pGEM-T easy vector (Promega), then released with

restriction enzyme SmaI and subcloned into the T-DNA

portion of pBI121 vector, which was digested with the

same restriction enzyme (Figure 1). Both recombinant

pGEM-T easy and pBI121 vectors were transformed into

and replicated in E. coli DH5£\ cells. The correctness of

these constructs in recombinant pGEM-T easy and pBI121

vectors was also confirmed by DNA sequencing using an

ABI PRIZM 337 DNA sequencer. After confirmation, the

correct recombinant pBI121 vector was transferred into

Agrobacterium tumefaciens LBA4404 competent cells

(Clonetech), with electroporation following the protocol

supplied by the manufacturer (BIO-RAD). Transformed

Agrobacterium tumefaciens cells were confirmed by PCR

amplification using gene-specific primers as described

earlier and utilized for Arabidopsis transformation with

the floral dip method (Clough and Bent, 1998). After

transformation, the Arabidopsis plant continued to grow

CHEN et al. ¡X Sweet potato asparaginyl endopeptidase

111

Figure 1. Cons truction of a full-

length cDNA of sweet potato SPAE

in T-DNA of recombinant pBI121

ve ctor. A, T he ful l-length cDNA

s equ ence of s weet potato SPAE;

B, Construction of the full-length

cDNA (from ATG initiation codon

to TAA stop codon) of sweet potato

SPAE within the T-DNA portion

of pBI121 vector. The upper is the

uncons tructed T-DNA portion of

pBI121 (pBI121). The lower is the

r ec om bin ant T-D NA por ti on of

rec om binant pBI121 (YP ) which

c ontains sweet potato SPAE full-

length cDNA under the control of

CaMV 35S promoter. X: XmaI;

S : Sma I; AT G: s tart codon; Kan

R: Kanamycin-resistance gene

a s a s e le c t a b l e m a rk e r ; GU S :

£]-Glucuronidase; RB: right border

o f T-DN A; L B : l e ft bo rd e r of

T-DNA.

until seed set. These seeds were assigned as T0 seeds

and collected for screening of transgenic T0 Arabidopsis

seedlings.

identification and characterization of transgenic

Arsbidopsis plants

Transgenic T0 seedlings were identified and isolated

after seed germination on half-strength MS salt medium

with 1% sucrose, 500 £gg/mL cefotaxine, and 50 £gg/mL

kanamycin under a regime of 22¢XC day/18¢XC night, 16

h light/8 h dark. The seedlings with a green phenotype

were identified as putative transgenic T0 plants. These

plants were then transferred to soil and grown in the

growth chamber until flowering and T1 seed set. T1 seeds

were collected and germinated on half-strength MS salt

medium with 1% sucrose, 500 £gg/mL cefotaxine, and 50

£gg/mL kanamycin under the same light/dark regime. The

T1 seedlings with a green phenotype were identified as

putative transgenic plants and used for characterization as

described below.

Genomic Pcr amplification of SPAE

Putative transgenic T1 seedlings with a green

phenotype grown on kanamycin-containing medium for

2 to 3 weeks after germination were transferred to soil

and grown in a growth chamber under regime of 22¢XC

day/18¢XC night, 16 h light/8 h dark. Leaf tissues of these

putative transgenic T1 plants were collected for genomic

PCR. About 0.5 g of putative transgenic T1 Arabidopsis

and control plant samples were collected individually for

genomic DNA isolation with the CTAB method (Chen

et al., 2004). The same amount of purified genomic

DNAs isolated from control and putative transgenic

plants were used for PCR amplification with the primer

pair (5¡¦ primer: ATGATTCGCTCCGTCGTCGC and 3¡¦

primer: TTATGCACTGAA TCCTCCTC) to confirm the

presence of full-length SPAE cDNA in putative transgenic

Arabidopsis plants (Jonson et al., 2000).

112

Botanical Studies, Vol. 49, 2008

Protein gel blot hybridization

Putative transgenic T1 seedlings with a green

phenotype grown on kanamycin-containing medium for

2 to 3 weeks after germination were transferred to soil

and grown in a growth chamber under a regime of 22¢XC

day/18¢XC night, 16 h light/8 h dark. Leaf tissues of these

putative transgenic T1 plants were collected for protein gel

blot hybridization. About 0.3 g samples of transgenic T1

Arabidopsis and control plants were collected individually

for total protein isolation, and ca. 100 £gg total protein of

each sample was used for protein gel blot hybridization

with the polyclonal antibodiy against SPAE protein (Chen

et al., 2004).

Analysis of morphological characteristics

Several phenotypic characters were observed and

qualitatively or quantitatively compared between control

and transgenic T1 plants. These characters included the

time of transition from vegetative to reproductive growth,

senescence of leaf, the silique and seed development, the

number of seeds per silique, and the number of siliques per

plant. Seedlings of transgenic T1 and control plants were

grown under the same environmental conditions (22¢XC

day/18¢XC night, 16 h light/8 h dark) in a growth chamber.

The transition from vegetative phase to reproductive

phase was compared and recorded once the inflorescence

and flower had set. After flowering, the silique and seed

development were also examined. Arabidopsis siliques

were arbitrarily classified into four types (1 to 4) according

to their morphologies after maturation. The morphology of

different silique types, the number of seeds per silique of

different types, and the percentage of incomplete silique

development were compared and recorded among control

and transgenic T1 plants.

reSULtS

Sweet potato SPAE gene is identified and

expressed in transgenic Arabidopsis plants

In order to study the possible function of sweet ptato

SPAE, its full-length cDNA was constructed in the T-DNA

portion of pBI121 vector and transferred into Arabidopsis

plants with the Agrobacterium-mediated floral dip

transformation method. Transgenic Arabidopsis plants

were isolated and identified using kanamycin resistance

and genomic PCR amplification of SPAE full-length

cDNA. In this experiment ca. 1 out of 5,000 to 10,000

seeds screened was identified as putative transgenic.

Therefore, the transformation frequency was about 0.1%

to 0.2%. Three putative transgenic T0 seedlings with green

phenotype were isolated and designated YP1, YP2, and

YP3. These putative transgenic plants were transferred to

soil and grew until flowering and T1 seed had set. These

T1 seeds were germinated on kanamycin-containing MS

medium, and seedlings with green and white phenotypes

were observed due to the meiotic segregation of the insert

gene. Kanamycin-resistant T1 seedlings from YP1, YP2

and YP3 were identified as transgenic and utilized for

further characterization.

Figure 2 shows the PCR products from genomic

DNAs isolated from transgenic T1 seedlings and

nontransformant control. The PCR products amplified

with primers for SPAE full-length cDNA were detected

and had molecular masses between 1.5 kb and 2.0 kb for

all transgenic T1 seedlings of YP1, YP2 and YP3, but

not for nontransformant control. These data demonstrate

the presence of sweet potato SPAE gene in transgenic T1

seedlings. Protein gel blot hybridization with polyclonal

antibody raised against SPAE (Chen et al., 2004) showed

that a band with a molecular mass between 34 kDa and

40 kDa was detected from samples of sweet potato S1

senescent leaves and transgenic T1 Arabidopsis seedlings,

but not from samples of sweet potato S0 mature young

leaves and nontransformant Arabidopsis control (Figure

3). An extra band with a molecular mass between 40 kDa

and 55 kDa was also detected from samples of transgenic

T1 Arabidopsis plants, but not from samples of sweet

potato S0/S1 mature young leaves and nontransformant

Arabidopsis control (Figure 3). The reason is not clear.

However, one of the possible explanation is that the

extra band with higher molecular mass than the predicted

mature form of SPAE protein may be due to the incomplete

or lower processing efficiency of sweet potato SPAE

precursor in transgenic T1 Arabidopsis plants than in

sweet potato S1 senescent leaves. These data demonstrate

that sweet potato SPAE can be expressed and processed

into a mature form of SPAE protein in transgenic T1

Arabidopsis plants.

Figure 2. Genomic PCR analys is of putative transgenic T1

Arabidopsis plants. Total genomic DNA from nontransformant

control and three isolated transgenic T1 Arabidopsis plants

(YP1, YP2 and YP3) were analyzed for the presence of sweet

potato SPAE gene. C and YP1/YP2/YP3 denote nontransformant

control and transgenic Arabidopsis plants, respectively. M

represents the molecular weight marker.

CHEN et al. ¡X Sweet potato asparaginyl endopeptidase

113

transgenic t1 Arabidopsis plants exhibited

earlier flowering and leaf yellowing

In order to characterize the effects of sweet potato

SPAE gene expression on the phenotypic properties of

Arabidopsis transgenic plants, the growth patterns were

compared and recorded among nontransformant control

and transgenic T1 Arabidopsis plants. Transgenic T1

Arabidopsis plants expressing SPAE exhibited earlier floral

transition from vegetative growth than nontransformant

control ca. 30 to 35 days after seed germination

(Figure 4A). Early flowering is generally considered

a phenomenon of senescence. During seed and silique

development, the lower leaves of Arabidopsis plants

began to senesce, and a higher degree of leaf yellowing

was observed for transgenic T1 Arabidopsis plants than

for nontransformant control plants around 7 weeks

after seed germination (Figure 4B). These data support

the conclusion that sweet potato SPAE is a senescence-

associated gene and its expression likely enhances or

promotes senescence in transgenic Arabidopsis plant.

transgenic t1 Arabidopsis plants contained

higher percentage of incompletely-developed

siliques and fewer siliques per plant

The phenotypic effects of sweet potat SPAE gene

expression on the silique and seed development of

transgenic T1 Arabidopsis plants were also investigated

and recorded. First of all, four types of siliques were

classified according to their morphologies and seed

numbers per silique. Type 1 silique exhibited a fully-

developed morphology (Figure 5A and 5B) with ca. 55

seeds per silique (Figure 6A). Type 2 silique displayed

a slightly shorter and thinner morphology (Figure 5A

and 5C) with ca. 32 seeds per silique (Figure 6A). Type

F igu re 3. P rot ein gel blot hybridiza tion of trans genic T 1

Arabidopsis plants with rabbit polyclona l antibody agains t

sweet potato SPAE protein. S0 and S 1 represent sweet potato

m at ure yo ung an d se nes c ing le ave s wi th 10 0% and 25%

chlorophyll contents, respectively. C and YP1/YP2/YP3 denote

nontransformant control and trans genic Arabidopsis plants,

respectively.

3 silique had an incompletely-developed morphology

with a size drastically reduced to about one-half of the

type 1 silique (Figure 5A and 5D) and ca. 20 seeds per

silique (Figure 6A). Type 4 silique also showed a highly

underdeveloped morphology with size reduced to about

one-third of the type 1 silique (Figure 5A and 5E) and ca.

6 seeds per silique (Figure 6A). Types 2, 3 and 4 were

grouped together as the incompletely-developed siliques,

and the percentage was compared among transgenic

T1 Arabidopsis plants and nontransformant control.

Transgenic YP1 (25.43%), YP2 (23.98%), and YP3

(31.40%) plants contained much higher incompletely

developed silique percentages than control (2.19%) (Figure

6B). In addition, transgenic YP1 (57), YP2 (78) and YP3

(57) had significantly fewer siliques per plant than control

(99) (Figure 7). The percentages of silique numbers per

plant of T1 transgenic Arabidopsis were about 60 to 80%

that of control. These data demonstrate that SPAE gene

expression may influence seed and silique development

and result in reduced seed number per silique, smaller

silique numbers per plant, and a higher percentage of

incompletely developed siliques per plant in transgenic

Arabidopsis plants.

DiScUSSioN

In this report, three transgenic Arabidopsis plants were

isolated and identified with the floret dip transformation

method (Clough and Bent, 1998). Genomic PCR and

protein gel blot analysis confirmed that these Arabidopsis

plants (YP1, YP2 and YP3) were transgenic and contained

the foreign sweet potato SPAE gene in their genomes

(Figure 2), which can be expressed as mature protein

products (Figure 3). Two bands were detected in transgenic

T1 Arabidopsis plants. The lower band, with molecular

mass between 34 kDa and 40 kDa, has a band position

similar to that of the positive control from sweet potato

S1 senescent leaves. The putative mature form of SPAE

after removal of N-terminal and C-terminal prosegments

contains 325 amino acids and has a predicted molecular

mass ca. 36 kDa (Chen et al., 2004). Therefore, the lower

band likely represents the mature form of SPAE. The upper

band with molecular mass between 40 kDa and 55 kDa

was close to the predicted molecular mass of the putative

intermediate form of SPAE, which contained 442 amino

acids after removal of N-terminal prosegment and had a

predicted molecular mass ca. 49 kDa. Therefore, the upper

band likely represents the intermediate form of SPAE.

Similar results have also been observed and reported for

various plant vacuolar processing enzymes, including

Vigna mungo VmPE-1 (Okamoto et al., 1999), Arabidopsis

£]VPE (Gruis et al., 2002), Arabidopsis £^VPE (Kuroyanagi

et al., 2002; Rojo et al., 2003). These data also support the

conclusion that transgenic Arabidopsis plants may contain

similar processing mechanisms for correcting sweet potato

SPAE processing and thus can produce mature sweet

potato SPAE protein products.

114

Botanical Studies, Vol. 49, 2008

Transgenic Arabidopsis plants exhibited an earlier floral

transition from vegetative growth and leaf senescence

(Figure 4). Early transition from a vegetative phase to

the reproductive phase has been reported as a type of

senescence. The reasons and mechanisms that allow

sweet potato SPAE gene expression to promote earlier

floral transition and enhance senescence in transgenic

Arabidopsis plants are not clear. However, Raper et al.

(1988) and Rideout et al. (1992) hypothesized that floral

transition is stimulated by an imbalance in the relative

availability of carbohydrate and nitrogen in the shoot

apical meristem. Therefore, whether SPAE expression can

interfere with the endogenous metabolic balance, which

in turn leads to accelerated senescence, awaits further

investigation.

Expression of sweet potato SPAE in transgenic

Arabidopsis plants caused reduced seed number per

silique, an elevated number of incompletely-developed

silique, and smaller silique numbers per plant (Figures

5, 6 and 7). The reasons for the altered phenotypic

characteristics in transgenic Arabidopsis by sweet potato

SPAE expression are not clear. However, sweet potato

SPAE is in close association with the plant vacuolar

processing enzymes of seeds from phylogenic analysis

(Chen et al., 2004). These enzymes have been implicated

in the degradation and mobilisation of the storage proteins

called globulins during seed germination and seedling

growth in Phaseolus vulgaris (Senyuk et al., 1998), Vigna

mungo (Okamoto et al., 1999), Vicia sativa (Schlereth et

al., 2000; Schlereth et al., 2001), and Arabidopsis thaliana

(Gruis et al., 2002). In Vigna mungo, VmPE-1 has been

demonstrated to increase in the cotyledons of germinating

seeds and was involved in the post-translational processing

of a vacuolar cysteine endopeptidase, designated SH-

EP, which degraded seed storage proteins (Okamoto and

Minamikawa, 1999). Whether it is inappropriate pre-

degradation of globulin-type storage protein during seed

development and maturation by constitutively expressed

sweet potato SPAE in transgenic Arabidopsis that results

in partial repression of seed and silique development and

in turn lead to a higher incompletely-developed silique

percentage (Figures 5 and 6) and lower silique numbers

Figure 4. C om p a ri s o n o f gr o w t h p a t t e rn s b e t w e e n

nontransformant control and transgenic T1 Arabidopsis plants,

YP3. A, Floral transition from vegetative growth was observed

at ca. 30 to 35 days after seed germination; B, Leaf senescence

during seed and silique development was recorded at ca. 6 to 7

weeks after seed germination.

Figure 5. Cl as s i fic at ion of s i li que s ac co rdi ng t o t hei r

morphology. A, There are four types of siliques (types 1, 2, 3

and 4) classified; B, Dissection of type 1 silique; C, Dissection

of type 2 silique; D, Dissection of type 3 silique; E, Dissection

of type 4 silique.

CHEN et al. ¡X Sweet potato asparaginyl endopeptidase

115

per plant (Figure 7) awaits further investigation. Based on

these results we conclude that sweet potato asparaginyl

endopeptidase, SPAE, may function in association with

the senescence process, and its expression enhances or

promotes senescence in transgenic Arabidopsis plants.

Acknowledgment. The authors thank the financial

support (NSC93-2313-B-034-002 and NSC95-2313-

B-034-003-MY2) from the National Science Council,

Taiwan, ROC.

LiterAtUre citeD

Abe, Y., K. Shirane, H. Yokosawa, H. Matsushita, M. Mitta, I.

Kato, and S . Ishii. 1993. Asparaginyl endopeptidases of

jack bean seeds. J. Biol. Chem. 268: 3523-3529.

Becker, C, A. D., V. H. S hut ov, V. I. Nong, R. S enyuk, C.

Jung, J. Horstmann, N. Fischer, C. Nielsen, and K. Muntz.

1995. P urific ation, cDNA cloning and c haracterization

o f prote ina s e B, a n as pa ragi nyl e ndope pti das e from

germinating vetch (Vicia satava L.) seeds. Eur. J. Biochem.

228: 456-462.

Buchanan-Wollas ton, V. 1997. The molecular biology of leaf

senescence. J. Exp. Bot. 48: 181-199.

Chen, H.J., W.C. Hou, J .S. Liu, C.Y. Yang, D.J. Huang, and

Y.H. Lin. 2004. Molecular cloning and characterization of

a cDNA encoding asparaginyl endopeptidase from sweet

potato (Ipomoea batatas (L.) Lam) senescent leaves. J. Exp.

Bot. 55: 825-835.

Clough, S.J. and A.F. Bent. 1998. Floral dip: a simplified method

for Agrobacterium-mediated transformation of Arabidopsis

thaliana. Plant J. 16: 735-743.

Gruis, D.F., D.A. Selinger, J.M. Curran, and R. Jung. 2002.

Redundant proteolytic mechanis ms process seed storage

p rotei ns i n the a bse nce of se ed-ty pe me mbe rs of the

vacuolar processing enzyme family of cysteine proteases.

Plant Cell 14: 2863-2882.

Hara-Nishimura, I., K. Inoue, and M. Nishimura. 1991. A unique

vacuolar processing enzyme responsible for conversion of

several proprotein precursors into the mature forms. FEBS

Lett. 294: 89-93.

Hara-Nishimura, I., T. Shimada, N. Hiraiwa, and M. Nishimura.

1 995 . Va c uol ar pro ce s s ing en zy me re s po ns ib le for

maturation of seed proteins. J. Plant Physiol. 145: 632-640.

Hou, W.C., D.J. Huang, and Y.H. Lin. 2002. An aspartic type

prote ase degrades trypsin inhibitors , the major s torage

proteins of sweet potato Ipomoea batatas (L .) Lam cv.

Tainong 57. Bot. Bull. Acad. Sin. 43: 271-276.

Jons on, T., E. H. Mahla ma ki, R. Karhu, L. Gorunova, B.

J ohanss on, and M. Huglund. 2000. Characterization of

genomically amplified segments us ing PCR: Optimizing

relative-PCR for reliable and simple gene expression and

gene copy analyses . Genes Chromosomes Cancer 29:

192-199.

Kuroyanagi, M., M. Nishimura, and I. Hara-Nishimura. 2002.

F igu re 6. Com paris on of see d numbe r pe r sil ique am ong

diffe rent s ilique type s and incompletely-developed s ilique

pe rce ntage betwe en cont rol and t rans geni c T1 pl ants . A,

Comparison of seed number per silique among different silique

t ypes ; B, Com paris on of inc omple tel y-deve loped s ili que

percentage am ong control a nd transgenic T1 plants. C and

YP1/YP2/YP3 denote nontransformant control and transgenic

Arabidopsis plants, respectively. The data are from the average

of five plants per treatment and are shown as mean ¡Ó SE.

F igure 7. Com parison of si lique number per plant a mong

control and transgenic T1 plants. C and YP1/YP2/YP3 denote

nontransformant control and trans genic Arabidopsis plants,

respectively. The data are from the average of five plants per

treatment and are shown as mean ¡Ó SE.

116

Botanical Studies, Vol. 49, 2008

Activation of Arabidopsis vacuolar processing enzyme by

self-catalytic removal of an auto-inhibitory domain of the

C-terminal propeptide. Plant Cell Physiol. 43: 143-151.

Makino, A. and B. Osmond. 1991. Effects of nitrogen nutrition

o n n it ro ge n pa rt i ti oni ng be tw ee n c hl or opl a s ts a nd

mitochondria in pea and wheat. Plant Physiol. 96: 355-362.

Marty, F. 1999. Plant vacuoles. Plant Cell 11: 587-599.

Mitsuhashi, W., T. Koshiba, and T. Minamikawa. 1986.

S eparation and characterization of two endopeptidases

from cotyledons of germinating Vigna mungo seeds. Plant

Physiol. 80: 628-634.

Okamoto, T. and T. Minamikawa. 1999. Molecular cloning

and characterization of Vigna mungo processing enzyme 1

(VmPE-1), an asparaginyl endopeptidase possibly involved

in post-translational process ing of a vacuolar cysteine

endopeptidase (SH-EP). Plant Mol. Biol. 39: 63-73.

Okamot o, T. and T. Minam ikawa. 1995. P urifica tion of a

processing enzyme (Vm PE-1) that is involved in pos t-

translational processing of a plant cysteine endopeptidase

(SH-EP). Eur. J. Biochem. 231: 300-305.

Okamoto, T., A. Yuki, N. Mitsuhashi, and T. Mimamikawa. 1999.

Asparaginyl endopeptidase (VmP E-1) and autocatalytic

processing synergistically activate the vacuolar cysteine

proteinase (SH-EP). Eur. J. Biochem. 264: 223-232.

Quirino, B.F., Y.S. Noh, E. Himelblau, and R.M. Amasino. 2000.

Molecular aspects of leaf senescence. Trends Plant Sci. 5:

278-282.

Raper, C.D. J., J.F. Thomas, L. Tolley-Henry, and J.W. Rideout.

1988. As sess ment of an apparent relationship between

availability of soluble carbohydrates and reduced nitrogen

during floral initiation in tobacco. Bot. Gaz. 149: 289-294.

Rideout, J.W., C.D. Raper, and G.S. Miner. 1992. Changes in

ratio of soluble sugars and free amino nitrogen in the apical

meristem during floral transition of tobacco. Int. J. Plant

Sci. 153: 78-88.

Rojo, E., J. Zouhar, C. Carter, V. Kovaleva, and N. V. Raikhel.

2003. A unique mechanism for protein proces sing and

degradation in Arabidopsis thaliana. Proc. Natl. Acad. Sci.

USA 100: 7389-7394.

Schlereth, A., C. Becker, C. Horstmann, J. Tiedemann, and K.

Muntz. 2000. Comparison of globulin mobilization and

cysteine proteinas es in embryonic axes and cotyledons

during germination and seedling growth of vetch (Vicia

sativa L.). J. Exp. Bot. 51: 1423-1433.

Schlereth, A., D. Standhardt, H. P. Mock, and K. Muntz. 2001.

Stored cysteine proteinases start globulin mobilization in

protein bodies of embryonic axes and cotyledons during

vetch (Vicia s ativa L .) s eed ge rminat ion. P la nta 212:

718-727.

S cott, M.P., R. Jung, K. Muntz, and N.C. Niels en. 1992. A

protease respons ible for post-translational cleavage of a

cons erved Asn-Gly linkage in glyc inin, the major s eed

storage protein of soybean. Proc. Natl. Acad. Sci. USA 89:

658-662.

Senyuk, V., V. Rotari, C. Becker, A. Zakharov, C. Horstmann, K.

Muntz, and L. Vaintraub. 1998. Does an asparaginyl-specific

cys teine endopeptidase trigger phaseolin degradation in

cotyledons of kidney bean seedlings. Eur. J. Biochem. 258:

546-558.

Shimada, T., N. Hiraiwa, M. Nishimura, and I. Hara-Nishimura.

1994. Vacuolar processing enzyme of soybean that converts

proproteins to the corresponding mature forms. Plant Cell

Physiol. 35: 713-8.

S him ada , T., Yamada, K., and M. Kataoka. 2003. Vacuolar

processing enzymes are es sential for proper processing

of seed s torage proteins in Arabidopsis thaliana. J. Biol.

Chem. 278: 32292-32299.

Vierstra, R. D. 1996. Proteolysis in plants: mechanis ms and

functions. Plant Mol. Biol. 32: 275-302.

CHEN et al. ¡X Sweet potato asparaginyl endopeptidase

117