pg_0001

Botanical Studies (2008) 49: 199-213.

These authors have equal contribution to the study.

Corresponding author: E-mail: chaiyourong1@163.

com; ljn1950@swu.edu.cn; Tel: +86-23-68250744, Fax:

+86-23-68251950.

INTRODUCTION

Purple acid phosphatases (PAPs; E.C. 3.1.3.2) are a

class of tartrate-resistant enzymes that contain a metal-

binding dinuclear center in their active sites and catalyze

the hydrolysis of activated phosphoric acid esters and

anhydrides at a pH range from 4 to 7 (Klabunde et al.,

1995). These enzymes are readily distinguished from

other acid phosphatases (APases) by their characteristic

purple color, which is attributed to a charge transfer from

tyrosine to Fe(III) at ~560 nm (Vincent et al., 1992).

The Arabidopsis thaliana genome is annotated with 29

PAPs, while only 1 histidine APase, 4 vegetative storage

protein type of APases, and 10 phosphatidic APases,

suggesting that PA P genes may play crucial roles in plant

P metabolism (Li et al., 2002).

PAPs from animals, plants and microbes have been

isolated and characterized (Schenk et al., 2000b).

The mammalian PAPs are monomeric proteins of

approximately 35 kDa and exist in 2 forms: an oxidized,

purple form containing an Fe(III)-Fe(III) center, which

exhibits little if any catalytic activity; and a pink, reduced

form containing a mixed-valent Fe(III)-Fe(II) center,

which is the enzymatically active species (Vincent et

al., 1992). They mainly distribute in porcine uterine

fluid (uteroferrin, Uf), bovine spleen, human bones and

macrophages, and function in in vivo iron transport, bone

resorption, antigen presentation and some redox reactions

(Olczak et al., 2003).

Isolation, characterization and phosphate-starvation

inducible expression of potential Brassica napus

PURPLE ACID PHOSPHATASE 17 (BnPAP17) gene family

Kun LU

1,3

, Jia-Na LI

1,3

, Wei-Ran ZHONG

, Kai ZHANG

, Fu-You FU

, and You-Rong CHAI

1,3,

Chongqing Rapeseed Technology Research Center; Chongqing Key Laboratory of Crop Quality Improvement; Key Lab

of Biotechnology & Crop Quality Improvement of Ministry of Agriculture; College of Agronomy and Biotechnology,

Southwest University, Tiansheng Road 216#, Beibei, Chongqing, 400716, P. R. China

State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences,

Beijing 100101, P. R. China

(Received September 20, 2007; Accepted February 26, 2008)

ABSTRACT.

Three members of a Brassica napus PURPLE ACID PHOSPHATASE 17 (BnPAP17) gene

family were isolated. The full-length cDNAs of BnPAP17-1, BnPAP17-2 and BnPAP17-3 are 1277, 1356 and

1349 bp, with corresponding genomic sequences of 1466, 1594 and 1598 bp, respectively. The deduced 337-aa

BnPAP17-1, 333-aa BnPAP17-2 and 333-aa BnPAP17-3 proteins are all secretary low molecular weight (LMW)

PAPs, containing a metallophos domain, 5-block conserved motifs and 7 metal-ligating residues. BnPAP17-2

and BnPAP17-3 are highly similar to each other, but distinct from BnPAP17-1. Southern analysis suggests that

these three genes comprise the entire BnPAP17 gene family. They are all mainly transcribed in reproductive

organs especially in bud. In vegetative organs, BnPAP17-2 and BnPAP17-3 are expressed in root, hypocotyl

and stem, while BnPAP17-1 expression is limited to root. In seedlings, these genes are all strongly induced

by phosphate-starvation, and return to basal levels after phosphate resupply. Thus they are suggested to play

important roles in reproductive development and adaptation to phosphorus deficiency.

Keywords: Brassica napus; Gene family; Purple acid phosphatase; Phosphate starvation.

Abbreviations: aa, amino acid; bp, base pair; DOI, days of induction; DOR, days of Pi resupply; HOI, hours

of induction; ORF, open reading frame; P, phosphorus; PA P, purple acid phosphatase; Pi, phosphate; RACE,

rapid amplification of cDNA ends.

Database Accession Nos: EU107164 (BnPAP17-1 gene), EU107165 (BnPAP17-1 mRNA), EU107166

(BnPAP17-1 premature mRNA), EU107167 (BnPAP17-2 gene), EU107168 (BnPAP17-2 mRNA), EU107169

(BnPAP17-3 gene), and EU107170 (BnPAP17-3 mRNA).

moleCulAR BIology

pg_0002

200

Botanical Studies, Vol. 49, 2008

In plants, PAPs have been divided into 2 groups: high

molecular weight (HMW) and low molecular weight

(LMW) PAPs. Plant HMW PAPs are homodimeric

proteins with ~55-kDa subunits. The precise crystal

structures, biochemical and biophysical properties of

plant HMW PAPs have been studied in a few instances,

such as the KbPAP (P80366) from red kidney bean and

IbPAP1 (AAF19821) from sweet potato (Strater et al.,

1995; Schenk et al., 2005). Though many plant HMW

PA P genes have been obtained, their biological functions

remain poorly known. The LaSAP1 mRNA (AB023385)

from white lupin accumulated in both roots and shoots

under Pi deficient conditions, while LaSAP2 (AB037887)

was only induced in roots. Mature LaSAP1 and LaSAP2

were suggested to be located to plasma membrane and

extracellular respectively (Wasaki et al., 1999; Wasaki et

al., 2000). Potato StPAP1 (AY598343) encodes a LMW

PAP similar to mammalian PAPs, and is highly expressed

in stem and root and insensitive to Pi-starvation, while

StPAP2 (AY598341) and StPAP3 (AY598342) encode

2 typical plant HMW PAPs, and are induced by Pi

deprivation in roots or both stem and roots respectively

(Zimmermann et al., 2004). Under low-Pi conditions,

the transcript level of alfalfa MtPAP1 (AY804257) was

reduced in leaves and increased in roots, with the strongest

signal detected in roots. MtPAP1 may function to improve

P acquisition in plants under Pi stress (Xiao et al., 2006).

In Arabidopsis, AtPAP11 (NM_127370) an d AtPAP12

(NM_128277) were up-regulated by Pi deficiency (Li et

al., 2002). Further study on AtPAP12 promoter showed

that it was specifically activated by Pi-starvation, while

salicylic or jasmonic acids and other inducers of gene

expression could not activate it (Haran et al., 2000). NaCl

stress and oxidative stress but not Pi-starvation induced

the expression of soybean GmPAP3 (AY151271) which

exhibited phytase activity in germination (Liao et al.,

2003). Moreover, two isoforms of tobacoo PAPs, NtPAP12

(BAC55155) and NtPAP21 (BAC55157), were associated

with cell wall generation (Kaida et al., 2003). These

studies indicate that plant HMW PAPs are multi-functional

proteins, which are necessary for plant P metabolism and

adaptation to low P conditions.

Plant LMW PAPs are much less well characterized

than plant HMW PAPs. Except for AtPAP17 (AtACP5,

NP_566587), most LMW PAPs are deduced from

corresponding cDNAs, e.g. AtPAP3 (NP_172923),

AtPAP4 (NP_173894), AtPAP7 (NP_178297), AtPAP8

(NP_973397) from A. thanalia, GmPAP (AAF60316)

from soybean, IbPAP (AAF60315) from sweet potato,

PvPAP (AAF60317) from common bean, and StPAP1

(AAT37529) from potato (Del Pozo et al., 1999; Oddie

et al., 2000; Li et al., 2002; Zimmermann et al., 2004).

AtPAP17 was purified as a 34-kDa monomer, containing

5-block conserved motifs and 7 metal-binding sites, and

its C-terminal sequence showed significant similarity with

mammalian PAPs. AtPAP17 transcript accumulation is

strongly induced by Pi starvation and is also responsive

to salt stress, abscisic acid, peroxide and senescence

(Del Pozo et al., 1999). Consequently, AtPAP17 has

been regarded as an important control index in several Pi

metabolism researches (Muller et al., 2004; Todd et al.,

2004).

Rapeseed (Brassica napus) is the second largest oil

bearing crop in the world, and is the most widely grown oil

crop in China (Yang et al., 2007). However, it is sensitive

to Pi limitation, which has become a crucial yield-limiting

factor for this crop, especially in the Yangtze River

rapeseed belt, despite the increased use of Pi fertilizers

(Guo et al., 2002). Owing to strong interactions of Pi with

other metal ions in soils, the majority of soil Pi is locked

in organic and immobile inorganic complexes. Less than

20% of applied fertilizer Pi could be assimilated by crops

during the first growth season, leading to an excess amount

of soil Pi that contributes to environmental problems

such as Pi-enrichment of water ecosystems. Screening

of P-efficient B. napus genotypes and study of their

adaptation mechanism to Pi-starvation are basic strategies

to improve Pi utilization efficiency as well as reduce Pi-

related water contamination with limited application of

non-renewable Pi-fertilizers. Here we report the isolation,

molecular characterization, and Pi-starvation induced

expression of the 3-member B. napus PAP17 (BnPAP17)

gene family that is othologous to AtPAP17, which adds

clues for functional and evolutionary characterization of

plant PAP17 genes and molecular biological elucidation of

Pi-deficiency responses in rapeseed.

mATeRIAlS AND meTHoDS

Plant materials

Seed of inbred line W17 of typical B. napus genetic type

(AACC, 2n=4x=38) were kept by Chongqing Rapeseed

Technology Research Center and grown under normal field

conditions. Root (Ro), hypocotyl (Hy), cotyledon (Co),

stem (St), leaf (Le), bud (Bu), flower (Fl), silique pericarp

(SP), and seed of 10 (10D), 20 (20D) and 30 d (30D)

after flowering were sampled. For Pi-starvation treatment,

W17 seedlings were cultured in full-strength Hoagland's

solution with a cycle of 16 h of artificial light at 25�XC and

8 h dark at 18�XC (Hoagland and Arnon, 1950). Four-week

old seedlings were subjected to Pi-starvation treatment (0.5

�gM KH

), and seedling leaves (SL) and seedling roots

(SR) were harvested after 0 h, 12 h, 24 h, 2 d, 4 d and 8 d

of treatments respectively, and sampled again after 4 d of

Pi resupply. All samples were immediately frozen in liquid

nitrogen, and stored at -80�XC.

Isolation of total RNA and DNA

Total genomic DNA was isolated from mixed young

leaves of 3 representative plants using a CTAB-based

method (Saghai-Maroof et al., 1984), while total RNA

from various organs was isolated using a slightly modified

CTAB method (Jaakola et al., 2001). Total RNA from

SR and SL was extracted using the Plant RNA Mini Kit

(Watson Biotechnologies, Inc., China). Each RNA sample

pg_0003

LU et al. �X Rapeseed

PURPLE ACID PHOSPHATASE 17

genes

201

was treated with RNase-free DNase I (TaKaRa) to remove

contaminating DNA. Quality and concentration of total

RNA and genomic DNA samples were assessed by agarose

gel electrophoresis and spectrophotometry, and stored at

-80�XC.

Amplification of the 3

��

and 5

��

cDNA ends of

BnPAP17 genes

RACE-ready total first-strand cDNA was synthesized

from 5 �gg of equally proportioned (w/w) mixture of total

RNA from SR and SL induced by varied degrees of Pi-

starvation using the GeneRacer kit (Invitrogen, USA).

According to multi-alignment of 29 A. thaliana PAP

genes, the sites conserved in AtPAP genes and specific for

AtPAP17 were chosen to design conserved-site primers for

amplification of 3�� and 5�� cDNA ends of BnPAP17 genes.

For 3��-RACE, conserved-site sense primers FPAP17-31

(5��-AGCAAGATGGAAGATTGTTGTTGG-3��) and

FPAP17-32 (5��-GAACGGTGTTGATCTCTACATGA

AT-3��) were designed. Using primers FPAP17-31 and

GeneRacer

3�� Primer (5��-GCTGTCAACGATACG

CTACGTAACG-3��), the 50-�gl primary polymerase

chain reaction (PCR) was conducted using 2 �gl of total

first-strand cDNA as template on a MyCycler gradient

thermocycler (Bio-Rad, USA): predenaturation at 94�XC

for 2 min, followed by 30 cycles of amplification (94�XC

for 1 min, 52�XC for 1 min, and 72�XC for 1 min), and by 72

�XC for 10 min. Then 0.2 �gl of primary PCR product was

used as template for nested PCR using primers FPAP17-32

and GeneRacer

3�� Nested Primer (5��-CGCTACGTAA

CGGCATGACAGTG-3��) with other conditions similar to

the primary PCR. In 5��-RACE, kit primers GeneRacer

5�� Primer (5��-CGACTGGAGCACGAGGACACTGA-3��)

and GeneRacer

5�� Nested Primer (5��-GGACACTGACA

TGGACTGAAGGAGTA-3��) were paired with conserved-

site antisense primers RPAP17-51 (5��-GAGTCGTGTCA

ACAAAGAACATCTC-3��) and RPAP17-52 (5��-GAAG

ACTTGGAGCAGTGTAGATGTTA-3��) for primary and

nested PCRs respectively, with other conditions identical

to those for 3�� primary PCR. PCR products were gel

purified then subcloned into pMD18-T vector (TaKaRa),

and transformed into E. coli DH5�\. Positive colonies were

sequenced using primers M13F and M13R at Invitrogen

Corporation, Shanghai, China.

Amplification of full-length cDNAs and genomic

sequences of BnPAP17 genes

Sense primers FPAP17-7 (5��-ATTTCCTTCTCCCT

CCCTCCC-3��) and FPAP17-12 (5��-ATCATCATCCTTC

GCACCTTAACC-3��), and antisense primers RPAP17-9

(5��- AATGCATTTGACTATAACATTAAGAAGATAAT

C-3��) and RPAP17-19 (5��-GATAGGGATGCTAAACTT

ATCTTAAATATATG-3��), were designed corresponding

to the utmost ends of the sequenced 5��- and 3��-RACE

products respectively. Primers were combined into 4 pairs,

FPAP17-7/RPAP17-9, FPAP17-12/RPAP17-9, FPAP17-7/

RPAP17-19 and FPAP17-12/RPAP17-19, for amplification

of full-length cDNAs of BnPAP17 members. In each

50-�gl PCR, 0.5 �gl of first-strand total cDNA was used as

template. After 2 min at 94�XC, 35 cycles of amplification

were performed (94�XC for 1 min, 52�XC for 1 min, 72�XC for

2 min), followed by 72�XC for 10 min. Primer combinations

successful in full-length cDNA amplifications were used

to amplify the corresponding genomic sequences by

replacing the template with 0.5 �gg of total genomic DNA

of line W17 under the same conditions. PCR products

were purified and subcloned, followed by sequencing.

Bioinformatic analysis

Sequence alignment, ORF translation, and calculation

of obtained sequences were conducted using Vector NTI

Advance program v. 10.3.0 (Invitrogen, USA). BLAST

and Conserved Domain search were carried out on the

NCBI website (http://www.ncbi.nlm.nih.gov). Protein

structures were predicted using online bioinformatic tools

linked by Expasy (http://www.expasy.org ) and SoftBerry

(http://www.softberry.com ) websites. BnPAP17 proteins

and other PAPs retrieved from GenBank were aligned with

ClustalX program v. 1.83. Subsequently, a phylogenetic

tree was constructed using Neighbor-Joining method with

MEGA program v. 3.1 (Thompson et al., 1997; Kumar

et al., 2004). The reliability of the tree was measured by

bootstrap testing with 1000 replicates.

Southern hybridization detection

Sixty-�gg aliquots of genomic DNA of line W17

were digested overnight at 37�XC with either DraI,

EcoRI, EcoRV, SacI o r XbaI (New England BioLabs,

USA) respectively. None of these enzymes cut

within the hybridization region of cloned BnPAP17

members. Digested DNA samples were fractionated

by electrophoresis on 0.8% agarose gel, transferred

to a positively charged nylon membrane (Roche,

Germany) through standard capillarity method.

Using primers FPAP17S (5��-CGTTAAAGAATA

CTACACAGAAGAAG-3��) and RPAP17S (5��-

GTGGCCTTGGATCTTTTTAAGG-3��), a 126-bp highly

conserved fragment was amplified using BnPAP17-1 full-

length cDNA as template at an annealing temperature of

58�XC and labeled with Digoxigenin-11-dUTP using PCR

DIG Probe Synthesis Kit (Roche, Germany). Hybridization

was performed at 40.5�XC for 16 h (DIG Easy Hyb, Roche,

Germany). Membrane washing and immunological

detection (DIG Wash and Block Buffer Set and DIG

Nucleic Acid Detection Kit, Roche, Germany) were

carried out according to the manufacturer��s protocols.

RT-PCR detection of tissue specificities and

Pi-starvation induced expression patterns of

BnPAP17 genes

Semi-quantitative reverse transcription-PCR (RT-

PCR) was adopted to detect the expression profiles

of the 3 BnPAP17 members in 11 organs. One-�gg

aliquots of total RNA extracted from each sample

pg_0004

202

Botanical Studies, Vol. 49, 2008

were used as templates in reverse transcription with

the Oligo dT-Adaptor Primer using RNA PCR Kit

(AMV) Ver. 3.0 (TaKaRa). The RT-PCR reaction for

a house-keeping gene using specific primers F26S (5��

-CACAATGATAGGAAGAGCCGAC-3��) and R26S (5��

-CAAGGGAACGGGCTTGGCAGAATC-3��) designed

according to a 534-bp conserved region of A. thaliana 26S

rRNA gene was performed to monitor sample uniformity

of initial RNA input and RT efficiency (Singh et al.,

2004). RT-PCRs were carried out in a 25-�gl volume.

26S rRNA gene amplification was performed under the

following condition: 94�XC for 2 min, followed by 21

cycles of amplification (94�XC for 1 min, 60�XC for 1 min

and 72�XC for 1 min), then 72�XC for 10 min. Primer pairs

FPAP17-1S (5��-TCCCTTCTCTTCTTTGCTTCGCAT-3��)

/ RPAP17-52, FPAP17-23S (5��-ACAATCAGTCTGTTG

TGGCCTAC-3��) / RPAP17-2S (5��-AGTGGTCGTGTCC

ATTCATATAG-3��), and FPAP17-23S / RPAP17-3S (5��-

CAGTGGTCATGTCCATTCATGTAA-3��) were used for

member-specific detection of BnPAP17-1, BnPAP17-2

and BnPAP17-3 respectively. Based on gradient PCR

results using W17 genomic DNA as template, the

highest annealing temperatures for efficient exponential

amplification of the 3 primer pairs were determined as 60

�XC, 61�XC and 61�XC respectively, and the specificity was

proved by no cross amplification among the 3 members

using colony plasmids as templates. For investigation

of expression patterns of BnPAP17 members under Pi-

starvation stress conditions, RNA samples from SR and SL

of different treatments were reverse-transcribed and genes

were amplified for 31 cycles respectively using above

conditions. PCR products were detected with agarose gel

electrophoresis and analyzed with UTHSCSA ImageTool

for Windows v. 3.00. In order to control experimental

error, all RT-PCRs were done with 3 replicates.

ReSulTS

Isolation of full-length cDNAs and genomic

sequences of 3 BnPAP17 genes

5��-RACE yielded 6 products that appear to represent 2

different genes. One gene was represented by products of

496, 498, 499 and 529 bp, which were identical to each

other except for alternative initiation sites, and another

605-bp product that shared sequence identity but possessed

a 109-bp unspliced intron corresponding to the 1st intron

of AtPAP17. The second gene was represented by a related

but unique 488-bp product. NCBI BLASTn indicated that

all of the 5�� cDNA products showed highest identities to

AtPAP17 mRNA (NM_112660).

3��-RACE also yielded 6 products, all of which share

identity with AtPAP17. These products also appear to

represent 2 different genes, one corresponding to 4

fragments (363, 360, 359 and 354 bp, poly A tail not

included) and another corresponding to 2 fragments (483

and 462 bp), with alternative polyadenylation sites in each

gene.

Four pairs of primers designed based on 5��- and 3��-

RACE results were used to amplify full-length cDNAs.

Only primer pairs FPAP17-7 / RPAP17-19 and FPAP17-12

/ RPAP17-9 yielded specific products. Amplification with

primer pair FPAP17-7 / RPAP17-19 resulted in a 1277-bp

unique full-length cDNA named BnPAP17-1, while

amplification with primer pair FPAP17-12 / RPAP17-9

yielded 2 homologous but obviously distinct full-length

cDNAs named BnPAP17-2 (1356 bp) and BnPAP17-3

(1349 bp). No full-length cDNA clone was identified that

retained intron I, suggesting that the non-excision event

detected with 5��-RACE is rare. It is unknown if this event

is biologically relevant. These same primer pairs were used

to amplify genomic sequences corresponding to the above

3 full-length cDNAs by substituting the template with total

genomic DNA of line W17. Gel detection indicated that

primer pair FPAP17-7 / RPAP17-19 yielded a bright band

of about 1450 bp, whereas a 1600-bp band for primer pair

FPAP17-12 / RPAP17-9. Sequenced genomic sequences

of BnPAP17-1, BnPAP17-2 and BnPAP17-3 were 1466

bp, 1594 bp and 1598 bp, respectively. The genomic

sequences were identical to respective full-length cDNAs

in exon regions.

molecular characterization of nucleotide

sequences of the 3 BnPAP17 genes

Genomic sequences of all members of BnPAP17 gene

family contain 2 introns with standard GT�KAG splicing

boundaries at the positions of those of AtPAP17: 391-499

bp and 657-736 bp in BnPAP17-1, 350-510 bp and

668-744 bp in BnPAP17-2, and 350-509 bp and 667-755

bp in BnPAP17-3 (Figure 1). The cDNA of BnPAP17-1

possesses a 1014-bp ORF (with stop codon) flanked by

a 189-bp 5�� UTR and a 74-bp 3�� UTR. The cDNAs of

BnPAP17-2 and BnPAP17-3 both have a 160-bp 5�� UTR

and a 1002-bp ORF, but differed in 3�� UTR length (187 bp

for BnPAP17-2 and 194 bp for BnPAP17-3). BnPAP17-1

has 4 alternative transcriptional start sites at A

, A

, T

and A

, 4 alternative polyadenylation sites right after C

1457

1462

, T

1463

and C

1466

, respectively, and a polyadenylation

signal A

1404

TAAA

1409

. BnPAP17-2 and BnPAP17-3 both

have 2 sites of polyadenylation signal AATAAA in their

3�� UTRs, and BnPAP17-2 also possesses 2 alternative

polyadenylation sites at T

1579

and T

1600

. Containing the

109-bp non-excised intron I, BnPAP17-1PM is 1386 bp

and its ORF is pre-terminated by intron-derived stop

codon TGA at 418-420 bp (Figure 1).

BnPAP17-2 and BnPAP17-3 share as high as 95.8%

genomic and 97.5% mRNA identities to each other, but

they are quite divergent from BnPAP17-1. AtPAP17,

BnPAP17-1 and BnPAP17-2/ BnPAP17-3 form a nearly

triangle relationship (Table 1).

Furthermore, PlantCARE (http://bioinformatics.psb.

ugent.be/webtools/plantcare/html/ ) predicted that several

types of cis-acting regulatory elements, such as light

responsive elements Sp1, GT1-motif, I-box and TCCC-

motif, core promoter element TATA-box and elements for

pg_0005

LU et al. �X Rapeseed

PURPLE ACID PHOSPHATASE 17

genes

203

pg_0006

204

Botanical Studies, Vol. 49, 2008

the anaerobic induction ARE and in endosperm expression

GCN4_motif were identified in the leader sequences of the

3 BnPAP17 genes, implying their possible regulation by a

wide range of environmental signals.

Southern hybridization detection for possible

members of BnPAP17 gene family

Southern analysis was used to investigate the number

of BnPAP17 gene family members. Three distinct bands

were detected for EcoRI, SacI and XbaI digests, while 2

bands were detected for DraI and EcoRV digests (Figure

6). Because these enzymes do not cut within the probed

region of the 3 cloned BnPAP17 genes, it is likely that the

BnPAP17 gene family consists of only the 3 members that

were isolated in this study. It is possible that other gene

members exist but these would have to share identical

digestion patterns for all the 5 enzymes.

Conservation and features of the 3 deduced

BnPAP17 proteins

The deduced BnPAP17-1, BnPAP17-2 and BnPAP17-3

proteins are 337, 333 and 333 aa respectively (Figure 2).

BnPAP17-1 possesses a calculated MW of 38.24 kDa

and a predicted isoelectric point (pI) value of 5.86, while

BnPAP17-2 and BnPAP17-3 are 37.80 kDa and 37.82 kDa

with pI values of 5.27 and 5.28 respectively. BnPAP17-1,

BnPAP17-2 and BnPAP17-3 are rich in S (10.09%, 9.61%

and 9.31% respectively). The ORF of BnPAP17-1PM

encodes a polypeptide of only 76 residues with a Mw of

8.40 kDa and a pI of 9.11. Its first 67 residues are identical

to those of BnPAP17-1, while the C-terminal 9 residues

have no homology to known proteins since they are

translated from the unspliced intron I.

BnPAP17 proteins show high similarities to one another

and other plant PAPs. Homology analysis on protein

sequences showed the same trend among BnPAP17-1,

BnPAP17-2, BnPAP17-3 and AtPAP17 as revealed on

nucleotide scale (Table 1). BnPAP17 proteins also share

55-63%/73-80% of identities/positives to yellow lupine

LlPAP (CAE85073), IbPAP, StPAP1, GmPAP and PvPAP,

with significant similarities mainly at the C-terminal

region.

Figure 1. Nucleotide alignment of AtPAP17 and the 3 BnPAP17 genes. The coding regions are underlined, with the start codon ATG

and the stop codon TGA in bold face and solid-underlined. The (alternative) initiation sites and (alternative) polyadenylation sites are

boxed, and the putative polyadenylation signals are double-underlined. Two conserved 3��-intron|5��-exon boundary sequences are in

bold italics. In 5�� and 3�� UTRs, conserved motifs (motifs 1-6), G-poor region and variable ATG context are marked. In BnPAP17-1, the

bases in the first intron participating in coding and premature termination in BnPAP17-1PM mRNA are dash-underlined.

Table 1. Sequence homology of BnPAP17 genes.

Identities (%) on genomic/mRNA level

Protein identities/similarities (%)

BnPAP17-1 BnPAP17-2 BnPAP17-3

AtPAP17

77.2/80.5 73.5/77.1 73.4/77.0 AtPAP17

85.2/90.2 82.8/88.2 83.4/88.8

BnPAP17-1

77.0/81.9 77.2/82.1 BnPAP17-1

89.3/93.5 89.6/94.1

BnPAP17-2

95.8/97.5 BnPAP17-2

98.5/99.4

pg_0007

LU et al. �X Rapeseed

PURPLE ACID PHOSPHATASE 17

genes

205

Figure 2. Multi-alignment of amino acid sequences of AtPAP17 and the 3 BnPAP17 proteins. In the consensus line, the predicted

conserved metallophos (pfam00149) domain between F

and C

256

is dash-underlined, the predicted signal peptide is solid-underlined,

five motifs of conserved amino acid sequences (GDWG, GDNF Y, GNHD, VVGH, and GHDH) are in gray background, those

conserved metal-binding residues (D

, D

, Y

, N

123

, H

217

, H

252

and H

254

in BnPAP17-1, and D

, D

, Y

, N

119

, H

213

, H

248

and H

250

BnPAP17-2 and BnPAP17-3) are boxed.

Figure 3. Phylogenetic relationship of deduced BnPAP17 proteins and related PAPs. Plant PAP sequences are: A. thaliana AtPAP3

(NP_172923), AtPAP4 (NP_173894), AtPAP5 (NP_564619), AtPAP7 (NP_178297), AtPAP8 (NP_973397), AtPAP10 (NP_179235),

AtPAP11 (NP_179405), AtPAP12 (NP_180287), AtPAP15 (NP_187369) and AtPAP17 (NP_566587), Solanum tuberosum StPAP1

(AAT37529) and StPAP3 (AAT37528), Glycine max GmACP5 (AAF60316), GmPAP3 (AAN85416) and GmPhy (AAK49438),

Phaseolus vulgaris PvPAP (AAF60317) and KbPAP (P80366), Ipomoea batatas IbPAP (AAF60315), IbPAP2 (AAF19822) and

IbPAP3 (CAA07280), Oryza sativa OsPAP (AAL34937), Nicotiana tabacum NtPAP12 (BAC55155) and NtPAP21 (BAC55157).

Vertebrate PAPs are: Danio rerio hypothetical protein LOC436725 (NP_001002452) and DrACP5 (NP_999938), Tetr aodon

nigroviridis (CAG03307), Xenopus laevis MGC78938 protein (AAH72062), Bos taurus BtACP5 (B27035), Homo sapiens Human

ACP5 (P13686), Sus scrofa Pig TRAP (P09889), Mus musculus Mouse AP5A (Q05117), Rattus norvegicus Rat TRRAP (P29288).

Bacterial PAPs are: Acidiphilium cryptum JF-5 (ZP_01144272) and Caulobacter sp. K31 (ZP_01419115). The analysis is performed

with ClustalX program and Mega program, and the tree is constructed by Neighbor-Joining method with p-distance. The number

for each interior branch is the percent bootstrap value (1000 replicates), and only values greater than 80% are shown. The scale bar

indicates the estimated number of amino acid substitutions per site.

Figure 3 shows the phylogenetic relationships of

BnPAP17 proteins with PAPs from plants and other

kingdoms based on ClustalX alignment and Neighbor-

Joining construction. Conforming to previous reports

(Zimmermann et al., 2004), these PAPs were classified

into 2 major groups (LMW PAPs and HMW PAPs), and

the LMW PAPs could be further divided into 3 distinct

subgroups (plant LMW PAPs, bacterial PAPs and

vertebrate PAPs). The BnPAP17 family is grouped with

AtPAP17 to form a highly related cruciferous cluster

within the LMW PAP subgroup. Deduced plant PAPs

such as AtPAP3, AtPAP4 and AtPAP8, GmPAP, PvPAP

and StPAP1 are also grouped within the plant LMW

PAP subgroup (Schenk et al., 2000a; Li et al., 2002;

Zimmermann et al., 2004). NCBI Conserved Domain

(CDD) search detected a metallophos (pfam00149)

conserved domain located at the C-terminal region of

BnPAP17 proteins. The domain resides between F

and C

255

of BnPAP17-1 with 89.5% alignments of the

184-residue CD-Length and F

-C

251

of BnPAP17-2 and

pg_0008

206

Botanical Studies, Vol. 49, 2008

BnPAP17-3 with 89.5% alignments for both (Figure 2).

Within this domain, the 3 BnPAP17 proteins bear the

same 5-block conserved motifs and 7 metal-binding

residues (GD

WG, GD

NFY

, GN

123

HD, VVGH

217

and GH

252

254

, bold letters for metal-ligating residues)

corresponding to those reported previously (Del Pozo et

al., 1999). These features suggest that the 3 BnPAP17

proteins are typical plant LMW PAPs.

SignalP 3.0 analysis suggests that BnPAP17-1,

BnPAP17-2 and BnPAP17-3 each possess a signal peptide,

with the most likely cleavage sites at G

-E

, G

-Q

and

-E

, respectively. TargetP 1.1, WoLFPSORT (http://

wolfpsort.seq.cbrc.jp/ ) and PSORT also predict that these

proteins are secreted. Based on predictions by TMpred,

TMHMM and ConPred II (http://bioinfo.si.hirosaki-u.

ac.jp/~ConPred2/), BnPAP17 proteins all have a significant

N-terminal transmembrane helix occupying the main part

of their signal peptides, e.g. from L

to V

BnPAP17-1, from T

to M

of BnPAP17-2, and

from T

to M

of BnPAP17-3. Thus, it is likely

that the 3 BnPAP17 proteins are extracellular

proteins, like

the reported AtPAP17 (Del Pozo et al., 1999).

Glycosylation is a typical feature of secreted plant

enzymes including PAPs (Olczak et al., 2003). NetNGlyc

1.0 predicted that the 3 BnPAP17 proteins all have

a potential N-glycosylation site NQSK. NetPhos 2.0

predicted 22-28 significant phosphorylation sites in each

BnPAP17 member (13-16 for S, 5-7 for T, and 4-5 for Y),

suggesting that phosphorylation may also be involved in

functional regulation of them.

Analysis of secondary and tertiary structures of

BnPAP17 proteins

Based on SOPMA prediction, BnPAP17-1, BnPAP17-2

and BnPAP17-3 contain 34.72%, 35.44% and 31.83%

of random coils, 29.97%, 31.53% and 31.83% of alpha

helices, 27.89%, 25.23% and 27.93% of extended strands,

and 7.42%, 7.81% and 8.41% of beta turns, respectively

(Figure 4). They all have 9 sites of obvious alpha helices

and 15-16 sites of obvious extended strands along the

whole molecule. It is noteworthy that there are 5 alpha

helices in the metallophos domain, and 6 of 7 metal-

binding sites are composed of random coil.

Crystal structures have been dissected for some plant

HMW PAPs (such as KbPAP and IbPAP1) and some

animal LMW PAPs, e.g. pig (PDB ID code 1UTE) and

rat (PDB ID code 1QHW) (Schenk et al., 2005). Tertiary

structures of BnPAP17 proteins were predicted by SWISS-

MODEL based on their 28%-29% identities to 1UTE

and 1QHW (Schwede et al., 2003). Displayed by Swiss-

PdbViewer 3.7 (SP5), BnPAP17 proteins are similar to one

another, especially that BnPAP17-2 and BnPAP17-3 show

only a slight difference at �]

-�\

(Figure 5). For BnPAP17

proteins, the main body is composed of 2 large sandwiched

�]-�\-�]-�\-�] folds (�]

-�\

-�]

-�\

-�]

and �]

-�\

-�]

-�\

-�]

). Each

sandwiched fold contains 3 parallel strands (�]

-�]

and

�]

-�]

), and the 2 sandwiched folds are connected by 2

small helices (�\

-�\

). Based on homologous alignment,

the binuclear metal centers of BnPAP17 proteins might

involve the D

-Y

-H

254

coordination and the N

123

217

-H

252

coordination to bind the 2 ions, and the 2 metal

ions in the active centers are bridged by the carboxylate

group of D

. The predicted tertiary structures proved these

residues and signified 2 Fe ion binding centers (Figure 5).

Expression of the 3 BnPAP17 genes in various

organs tested

Expression of each BnPAP17 gene family member

could be detected in all tested organs by 31-cycle RT-PCR,

with the highest in bud, followed by flower and 10D seed,

while lowest in cotyledon (Figure 7). For organ specificity,

though the 3 BnPAP17 genes show similar trends,

BnPAP17-2 is more similar to BnPAP17-3 than either

to BnPAP17-1, consistent with their sequence similarity

Figure 4. Predicted secondary structures of BnPAP17 proteins. Numbers 50, 100, etc., are counts of amino acids of each protein.

�\-helix, extended s trand, �]-turn and random coil are denoted as the longest, m iddle long, short and the shortest vertical bars

respectively.

pg_0009

LU et al. �X Rapeseed

PURPLE ACID PHOSPHATASE 17

genes

207

relationships. BnPAP17-1 is more organ-specific, while

BnPAP17-2 and BnPAP17-3 are more constitutive. The

highest transcript level of BnPAP17-1 could be detected

in bud, followed by 10D seed, flower, silique pericarp and

root, whereas its expression is weak in 20D seed and 30D

seed and almost non-detectable in hypocotyl, cotyledon,

stem and leaf. BnPAP17-2 and BnPAP17-3 also show the

strongest expression in bud, followed by flower, stem, root,

10D seed, hypocotyl, silique pericarp, leaf, and cotyledon.

While BnPAP17-2 shows weak expression in 20D seed

and 30D seed, BnPAP17-3 is almost undetectable in these

2 stages of seed.

Pi-starvation induced expression of BnPAP17

genes

The Pi-starvation induced expression patterns of

BnPAP17 family genes in seedling leaf (SL) and seedling

root (SR) were determined in line W17 treated for 0 h,

12 h, 24 h, 2 d, 4 d and 8 d of Pi-starvation and 4 d of Pi

resupply respectively. Only small amounts of BnPAP17

transcripts could be observed in SL and SR under Pi-

sufficient conditions (Figure 8). Under Pi-starvation

conditions, similar induction trends could be observed

between SL and SR. After 12 h of Pi-starvation, slight

induction could be observed both in SL and SR. The

expression levels continuously increased with time, and

reached the maximal levels after 8 d of treatment, which

was the most severe stress in this study. After 4 d of Pi

resupply, BnPAP17 expression dropped to near the basal

levels. BnPAP17-2 and BnPAP17-3 showed similar trends

to each other, but BnPAP17-1 differed in that it returned

to basal levels more slowly after Pi resupply. In SR,

BnPAP17-1 could be induced to an early peak level after

24 h of induction, while BnPAP17-2 and BnPAP17-3

needed 2 d.

DISCuSSIoN

Possible gene loss of the triplicated PAP17

genes in Brassica ancestor

There were close evolutionary relationship and strong

colinearity between the genomes of Brassica sepcies

and Arabidopsis (Lagercrantz and Lydiate, 1996). The

ancestor of Brassiceae triplicated its genome 13-17

million years ago (MYA), very soon after its divergence

from the ancestor of genus Arabidopsis about 17-18

MYA (Yang et al., 2006). "Diploid" Brassica species

such as B. oleracea and B. rapa are likely derived from a

hexaploid ancestry (Lukens et al., 2004). Their genomes

contain 3 representations of a basic genome, with each

representation being extensively collinear with A. thaliana

genome (Lysak et al., 2005). Brassica napus genome (1132

Mbp, 2n=38) is an amphidiploid of B. rapa AA-genome

(529 Mbp, 2n=20) and B. olerala CC-genome (696

Mbp, 2n=18), and is more than 6 times of the A. thaliana

genome (157 Mbp, 2n=10) (Johnston et al., 2005). It

Figure 5. Tertiary structures of BnPAP17-1, BnPAP17-2 and BnPAP17-3. Pig LMW PAP (1UTE) was used as the model in SWISS-

MODEL prediction, and Swiss-PdbViewer was adopted to show the results.

F igu re 6. Southern hybridization detection of homologous

BnPAP17 members in B. napus.

pg_0010

208

Botanical Studies, Vol. 49, 2008

is suggested that in B. napus there might exist about 6

orthologous genes corresponding to each gene from A.

thaliana (Cavell et al., 1998).

In this study, 3 BnPAP17 genes were isolated from B.

napus, and Southern analysis also detected just 3 (EcoRI,

SacI an d XbaI) or 2 (DraI and EcoRV) hybridization

bands. BnPAP17-1 shares only ~77% genomic identities to

the highly homologous BnPAP17-2/BnPAP17-3 sisters. As

the probe was a labeled BnPAP17-1 full-length cDNA, the

thickest band in each digestion may represent BnPAP17-1

itself, while the weaker band(s) may represent BnPAP17-2

or/and BnPAP17-3. The Southern hybridization result is in

good agreement with the cloned 3 members, thus it could

be postulated that B. napus probably contains only the 3

BnPAP17 genes isolated here.

AtPAP17, BnPAP17-1, and BnPAP17-2/ BnPAP17-3

form a nearly triangle relationship among them in

pairwise alignments, since AtPAP17 is 77.2% identical to

BnPAP17-1 and 73.4%/73.5% identical to BnPAP17-2/

BnPAP17-3 while BnPAP17-1 is 77.0%/77.2% identical

to BnPAP17-2/BnPAP17-3. BnPAP17-1 is a little more

orthologous to AtPAP17 than the other 2 members do. In

the phylogenetic tree constructed using protein sequences,

the 3 BnPAP17 proteins group together first and then

with AtPAP17 soon. So it is obvious that a duplication

event (most probably one event of the "triplication")

right after the Arabidopsis-Brassiceae split resulted in the

origination of BnPAP17-2/BnPAP17-3 from BnPAP17-1.

Loci in B. napus usually occur in homoeologous pairs, one

originating from B. rapa AA genome and another from B.

oleracea CC genome (Parkin et al., 2003). BnPAP17-2 and

BnPAP17-3 show high similarities in sequence structures,

tissue specificities and induced expression patterns, so they

are probably from respective subgenome-donor species,

i.e. they were orthologous to each other before the AA-CC

fusion.

From above analysis, it can be assumed that gene

loss might have occurred on the triplicated PAP17

genes in Brassica ancestor, and current B. rapa and B.

oleracea both might have only 1-2 PAP17 genes. But this

assumption needs to be identified by comparative cloning

of PAP17 genes from the 2 subgenome-donor species.

Several gene structure features deserve further

study

Alternative transcriptional initiation and

polyadenylation sites. BnPAP17-1 has 4 alternative

transcriptional initiation sites (A

, A

, T

and A

)

and 4 alternative polyadenylation sites (C

1457

, C

1462

1463

and C

1466

), and BnPAP17-2 also has 2 alternative

polyadenylation sites (T

1579

and T

1600

) (Figure 1). Length

of UTRs may influence the mRNA stability and translation

efficiency.

Conservative and variable regions in the 5�� UTRs.

The ~70-bp region just prior to the start codon ATG

is highly variable among AtPAP17, BnPAP17-1 and

BnPAP17-2/BnPAP17-3 (Figure 1). In conservative motifs

2 and 5, BnPAP17-1 is more similar to AtPAP17 than to

BnPAP17-2/BnPAP17-3, while in some other 5�� UTR

short motifs BnPAP17-1 is distinct from AtPAP17 and

BnPAP17-2/BnPAP17-3. These imply possible directional

evolution of the start codon context for certain regulatory

patterns in distinct PAP17 genes. The 11-bp motif 1

(CTCCCTCCTTC) and the 13-bp motif 3 (CTCTCT(A/

C)TTTCTC) is pyrimidine-rich and highly conservative,

implying possible important cis-element of PAP17 genes.

However, the 21-bp purine-rich motif 4 (AGAGA(A/

T)AGAGA(T/G)ATACAGATT) is just conserved among

BnPAP17 genes, suggesting its possible role in species-

specific regulation. Like B. napus F3��H-1 (Xu et al., 2007),

the first 121, 69, and 69 bp of 5�� UTRs of BnPAP17-1,

BnPAP17-2 and BnPAP17-3 respectively are also G-poor.

These features offer structural models for investigating 5

��

UTR cis-elements involved in transcription or translation

of PAP17-type genes.

Figure 7. Tissue s pecificities of BnPAP17 genes in various

organs tested. Ro: root; Hy: hypocotyl; Co cotyledon; St: stem;

Le: leaf; Fl: flower; Bu: bud; SP: silique pericarp; 10D: seed

of 10 D; 20D: s eed of 20 D; and 30D: s eed of 30 D. Band

intens it ies (c olumns ) were norma lize d to 26S rR NA band

intensity and expressed as relative transcript level. Error bars

indicate standard deviation (n=3).

pg_0011

LU et al. �X Rapeseed

PURPLE ACID PHOSPHATASE 17

genes

209

3�� UTR conserved motifs. Within the variable

3�� UTR, a cononical polyadenylation signal

AATAAA and a 26-bp T-rich motif 6 (GTTT(C/

T)TTTGTAATTTTTGTAACATAT) are also conserved

among PAP17 genes analysed (Figure 1). These kinds of

motifs are suggested essential for accurate and efficient 3��-

end formation (Ingelbrecht et al., 1989).

Conserved intron splicing border sequences. Most

introns in nuclear mRNA precursors follow GT�K

AG splicing sites, but further structure features should

be involved in (Breathnach and Chambon, 1981).

The 2 introns are highly variable among AtPAP17,

BnPAP17-1 and BnPAP17-2/BnPAP17-3, but their border

sequences are relatively conserved especially at the right

borders. The "3��-intron|5��-exon" boundary sequences

"intron I-TACAG|ATGGGAA-exon II" and "intron II-

GATGCAG|T-exon III" might be important for proper

intron splicing of PAP17 genes.

Intron retention. Alternative splicing creates

diversification of mRNA and protein products from a

gene and defines a means of genetic regulation (Black,

2003). Intron retention is assumed to be an ancient form of

alternative splicing in plants (Ast, 2004). In Arabidopsis,

about 30% of alternatively spliced gene products were

reported as intron retention (Ner-Gaon et al., 2004). In

cloning of B. napus phenylpropanoid pathway genes,

intron retention is often found on regulatory loci such

as TT2 (Wei et al., 2007). In this study, phenomenon of

intron retention was detected in BnPPA17-1 in GeneRacer

handling. The encoded 76-aa premature polypeptide

BnPPA17-1PM should be catalytically non-active as it

lacks almost the whole metallophos domain (Figure 1).

Since most of capped and polyadenylated BnPPA17-1

mRNA molecules are normally spliced, and BnPPA17-

1PM is unlikely to serve as a negative regulator, BnPPA17-

1PM might be a result of leaky splicing.

orthologous to AtPAP17, BnPAP17 proteins are

typical plant lmW PAPs

Plant PAPs could be divided into LMW PAPs of

~35-kDa and HMW PAPs of ~55-kDa based on their

MWs. Divergence between LMW PAPs and HMW PAPs

Figure 8. Pi-starvation induced expression patterns of BnPAP17 gene family. SL (A) and SR (B) were sampled after 0 h, 12 h, 24 h,

2 d, 4 d and 8 d of Pi-starvation treatments (P-) and 4 d after Pi resupply (RP), respectively. HOI: h of induction; DOI: d of induction;

DOR: d of Pi resupply. Band intensities (columns) were normalized to 26S rRNA band intensity and expressed as relative transcript

level. Error bars indicate standard deviation (n=3).

pg_0012

210

Botanical Studies, Vol. 49, 2008

was a very early event, probably occurred before the plant-

animal divergence (Del Pozo et al., 1999). In phylogenetic

tree, BnPAP17 proteins are closer to bacterial and

vertebrate PAPs rather than to plant HMW PAPs (Figure

4). So BnPAP17 proteins, which are 37.80-38.24 kDa,

are typcal plant LMW PAPs. Resembling AtPAP17, all

BnPAP17 proteins contain a metallophos domain, 5-block

conserved motifs and 7 metal-binding residues typical for

PAPs (Del Pozo et al., 1999). The OrthoMCL database

(http://orthomcl.cbil.upenn.edu ) searching revealed

that BnPAP17 proteins have highest identities/positives

(85%/92%) to ath14038 (AtPAP17). So, all BnPAP17

genes are orthologous genes of AtPAP17, and could be

assumed to be involved in Pi mobilization and in the

metabolism of reactive oxygen species (Del Pozo et al.,

1999).

As shown in Figure 5, BnPAP17 proteins are mainly

composed of 2 large sandwiched �]-�\-�]-�\-�] folds, which

were connected by 2-3 continuous �\ helices, implying that

BnPAP17 proteins have typical tertiary structure features

of PAPs. The binuclear metal centers of pig and rat PAPs

are Fe(III)-Fe(II) type, differring from Fe(III)-Zn(II) or

Fe(III)-Mn(II) center from plants (Olczak et al., 2003). To

date there is no report on crystal structure of plant LMW

PAPs, and there is also no evidence about the actual metal

ions bound in plant LMW PAPs. But the basic tertiary

structure together with a Fe-Fe binding center of BnPAP17

proteins was still predicted out based on mammalian PAPs,

suggesting that the core of three-dimensional structures of

plant LMW PAPs basically resembles mammal PAPs.

Implied functional importance and diverged

expression of PAP17 genes

In Arabidopsis, although 28 PA P genes differed in

their expression patterns in vegetative organs, but all

transcribed in flower, strongly implying that PA P genes

may play crucial roles in flower and seed development

(Zhu et al., 2005). AtPAP17 has been reported with the

highest expression in senescent leaf, followed by flower,

while weak expression in silique, root 1and stem (Del

Pozo et al., 1999). However, systemic RT-PCR detection

of AtPAPs indicated that AtPAP17 has the highest

expression in silique, while relatively low expression in

root, stem, leaf and flower (Zhu et al., 2005). In this study,

11 different organs were adopted to detailedly characterize

BnPAP17 member-specific expression patterns. Favoring

the results of Zhu et al. (2005), our results demonstrated

that BnPAP17 genes are also dominantly expressed

in reproductive organs. But BnPAP17 genes are most

intensively transcribed in flower bud, though also

intensive in mature flower and young seed (Figure 7).

Combinatorially, our results support a very important role

of BnPAP17 genes in the development of reproductive

organs of B. napus via their intensive expression through

the whole reproductive developmental stages, i.e. from

flower buds to mature flowers, then to developing seeds.

Our results also provide strong evidence suggesting the

involvement of BnPAP17 genes in Pi activation, absorption

and inter-organ transferring especially to the developing

reproductive organs in B. napus. First, relatively high

expression of BnPAP17 gene family was detected in

vascular tissues such as root, hypocotyl and stem, then

a path from root to vascular tissue then to reproductive

organs can be imagined along which BnPAP17 genes

show intensive expression. Second, expression of

BnPAP17 genes are strongly induced by Pi-starvation.

The degree of induction increased along with the severity

of the stress, and rapidly returned to near basal levels

after Pi resupply. Similar Pi resupply expression trend of

AtPAP17 was reported by Del Pozo et al. (1999). Muller

et al. (2004) also demonstrated that AtPAP17 showed a

clear reduction in transcript level after 1 h of Pi resupply,

especially in roots notable decrease only required 30 min,

preceding the change in shoots. The activity of AtPAP17

has been used as a marker for Pi deficiency researches in

Arabidopsis (Muller et al., 2004; Todd et al., 2004). Our

results basically conform to those of AtPAP17. Third, the

response of BnPAP17 genes to Pi-starvation was faster

in SL than in SR, which is in agreement with AtPAP12

(Haran et al., 2000). The most possible implication of

the phenomenon is that plants usually strive to utilize

endogenous P storage pools in the shoots by mediating

APase activity before to hydrolyze organic P complex in

soils via activation of APase in roots (Haran et al., 2000).

In this study, BnPAP17 members show distinct

differences in tissue specificities. BnPAP17-2 and

BnPAP17-3 show more similar organ specificity than either

to BnPAP17-1. BnPAP17-1 is more organ-specific, and

BnPAP17-2 and BnPAP17-3 are more widely expressed.

Besides important roles in developing reproductive organs,

intensive expression of BnPAP17-2 and BnPAP17-3 in

vascular tissues also indicates their roles in Pi absorption,

activation and transferring. However, the expression

of BnPAP17-1 is more limited to reproductive organs,

and root is the only vegetative organ with intensive

expression, implying its possible major roles in aspects of

Pi metabolism except long-distance Pi transferring. These,

together with the certain difference of organ specificity

between AtPAP17 and BnPAP17 family, suggest both

orthologous and paralogous divergence of expression

patterns of PAP17 genes, maybe for functional division,

complementation, and diversification.

Acknowledgements. This work was supported financially

by the National High Technology Research and

Development Program of China (863 Program) (Grant No.

2006AA10A113 and 2006AA100106).

lITeRATuRe CITeD

Ast, G. 2004. How did alternative splicing evolve. Nat. Rev.

Genet. 5: 773-782.

Black, D.L. 2003. Mechanis ms of alternative pre-messenger

RNA splicing. Annu. Rev. Biochem. 72: 291-336.

pg_0013

LU et al. �X Rapeseed

PURPLE ACID PHOSPHATASE 17

genes

211

B reat hnach, R. a nd P. Cham bon. 1981. Organiz ati on and

expression of eukaryotic split genes coding for proteins.

Ann. Rev. Biochem. 50: 349-383.

Cavell, A.C., D.J. Lydiate, I.A.P. Parkin, C. Dean, and M. Trick.

1998. Collinearity between a 30-centimorgan segment of

Arabidopsis thaliana chromosome 4 and duplicated regions

within the Brassica napus genome. Genome 41: 62-69.

Del Pozo, J.C., I. Allona, V. Rubio, A. Leyva, A. de la Pena,

C. Arago ncill o, and J. P az -Are s. 1999. A type 5 ac id

phosphatase gene from Arabidopsis thaliana is induced by

phosphate starvation and by some other types of phosphate

mobilising/oxidative stress conditions. Plant J. 19: 579-589.

Guo, Y.C., W.X. Lin, Q.M. S hi, Y.Y. Liang, F.G. Chen, H.Q.

He, and K.J. Li ang. 2002. S creening methodology for

rice (Oryza sativa) genotypes with high phosphorus us e

efficiency at their seedling stage. Chin. J. Appl. Ecol. 13:

1587-1591. (in Chinese)

Haran, S., S. Logendra, M. Seskar, M. Bratanova, and I. Raskin.

2000. Characterization of Arabidopsis acid phosphatas e

promoter and regulation of acid phosphatase expression.

Plant Physiol. 124: 615-626.

Hoagland, D.R. and D.L. Arnon. 1950. The water culture method

for growing plants without soil. Calif. Agric. Exp. Sta. Circ.

347: 32.

Ingelbrecht, I.L.W., L.M.F. Herman, R.A. Dekeyser, M.C. Van

Montagu, and A.G. Depicker. 1989. Different 3�� end regions

strongly influence the level of gene expression in plant

cells. Plant Cell 1: 671-680.

J aakola, L., A.M. Pirttil, M. Halonen, and A. Hohtola. 2001.

Isolation of high quality RNA from bilberry (Vaccinium

myrtillus L.) fruit. Mol. Biotechnol. 19: 201-203.

Johnston, J.S., A.E. Pepper, A.E. Hall, Z.J. Chen, G. Hodnett,

J . Drabe k, R. L opez, and H.J. P rice. 2005. Evolut ion

of genome s ize in Bras sicaceae. Ann. Bot. (Lond). 95:

229-235.

Kaida, R., K. Sage-Ono, H. Kamada, H. Okuyama, K. Syono,

and T.S. Kaneko. 2003. Isolation and characterization of

four cell wall purple acid phosphatase genes from tobacco

cells. Biochim. Biophys. Acta 1625:134-140.

Klabunde, T., N. Strater, B. Krebs, and H. Witzel. 1995.

Structural relationship between the m ammalian F e(III)-

Fe(II) and the Fe(III)-Zn(II) plant purple acid phosphatases.

FEBS Lett. 367: 56-60.

Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: integrated

software for molecular evolutionary genetics analysis and

sequence alignment. Brief. Bioinform. 5: 150-163.

Lagercrantz, U. and D.J. Lydiate. 1996. Comparative genome

mapping in Brassica. Genetics 144: 1903-1910.

Li, D., H. Zhu, K. Liu, X. Liu, G. Leggewie, M. Udvardi, and

D. Wang. 2002. P urple acid phosphatases of Arabidopsis

thaliana. C o m pa r a t i ve a n a l ys is a n d d i ff e re n t i a l

regulation by phosphate deprivation. J. Biol. Chem. 277:

27772-27781.

Liao, H., F.L. Wong, T.H. Phang, M.Y. Cheung, W.Y. Li, G.

S hao, X. Yan, and H.M. Lam , 2003. GmPAP3, a novel

purple acid phosphatase -like gene i n s oybea n induced

by NaCl stress but not phosphorus deficiency. Gene 318:

103-111.

Lukens, L.N., P.A. Quijada, J. Udall, J.C. Pires, M.E. Schranz,

and T.C. Osborn. 2004. Genome redundancy and plasticity

within ancient and recent Brassica crop species. Biol. J.

Linn. Soc. Lond. 82: 665-674.

Lysak, M.A., M.A. Koch, A. Pecinka, and I. Schubert. 2005.

Chromosome triplication found across the tribe Brassiceae.

Genome Res. 15: 516-525.

Muller, R., L. Nilsson, C. Krintel, and T.H. Nielsen. 2004. Gene

expression during recovery from phosphate s tarvation in

roots and shoots of Arabidopsis thaliana. Physiol. Plant.

122: 233-243.

Ner-Gaon, H., R. Halachmi, S . Savaldi-Goldstein, E. Rubin,

R. Ophir, and R. Fluhr. 2004. Intron retention is a major

phenomenon in alternative splicing in Arabidopsis. Plant J.

39: 877-885.

Oddie, G.W., G. Schenk, N.Z. Angel, N. Walsh, L.W. Guddat,

J. de Jersey, A.I. Cassady, S.E. Hamilton, and D.A. Hume.

2000. Structure, function, and regulation of tartrate-resistant

acid phosphatase. Bone 27: 575-84.

Olczak, M., B. Morawiecka, and W. Watorek. 2003. Plant purple

acid phosphatases- genes, structures and biological function.

Acta Biochim. Pol. 50: 1245-1256.

Parkin, I.A.P., A.G. Sharpe, and D.J. Lydiate. 2003. Patterns of

genome duplication within the Brassica napus genome.

Genome 46: 291-303.

Saghai-Ma roof, M.A., K.M. S oliman, R.A. Jorgens en, and

R .W. All a rd. 198 4. Ri bos o m al DNA s pa c er- le ng th

p ol ym o rp hi s m s i n ba rl e y: m e nd e li a n in he ri t an c e,

chromosomal location, and population dynam ics . Proc.

Natl. Acad. Sci. USA 81: 8014-8018.

Schenk, G., L.R. Gahan, L.E. Carrington, N. Mitic, M.

Valizadeh, S.E. Hamilton, J. de Jersey, and L.W. Guddat.

2005. Phosphate forms an unusual tripodal complex with

the Fe-Mn center of sweet potato purple acid phosphatase.

Proc. Natl. Acad. Sci. USA 102: 273-278.

Schenk, G., L.W. Guddat, Y. Ge, L.E. Carrington, D.A. Hume,

S . Ham ilton, and J. de Je rs ey. 2000a. Identification of

mammalian-like purple acid phosphatases in a wide range

of plants. Gene 250: 117-125.

Schenk, G., M.L. Korsinczky, D.A. Hume, S. Hamilton, and J.

de Jersey, 2000b. Purple acid phosphatases from bacteria:

similarities to mammalian and plant enzymes. Gene 255:

419-24.

Schwede, T., J. Kopp, N. Guex, and M.C. Peitsch. 2003. SWISS-

MODEL: an automated protein homology-modeling server.

Nucleic Acids Res. 31: 3381-3385.

Singh, K., J. Raizada, P. Bhardwaj, S. Ghawana, A. Rani, H.

S ingh, K. Kaul, and S. Kumar. 2004. 26S rRNA-based

internal control gene primer pair for reverse transcription-

polymerase chain reaction-based quantitative expression

s tudies in divers e plant s pecies . Anal. Biochem . 335:

330-333.

pg_0014

212

Botanical Studies, Vol. 49, 2008

Strater, N., T. Klabunde, P. Tucker, H. Witzel, B. Krebs. 1995.

Crystal structure of a purple acid phosphatase containing a

dinuclear Fe(III)-Zn(II) active site. Science 268: 1489-1492.

Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin, and

D.G. Higgins. 1997. The CLUSTAL_X windows interface:

flexible strategies for multiple sequence alignment aided by

quality analysis tools. Nucleic Acids Res. 25: 4876-4882.

Todd, C.D., P. Ze ng, A.M.R. Huet e, M.E. Hoyos , a nd J .C.

P olacco. 2004. Transcripts of MYB-like genes respond

to phosphorous and nitrogen deprivation in Arabidopsis.

Planta 219: 1003-1009.

Vincent, J.B., M.W. Crowder, and B.A. Averill. 1992. Hydrolysis

o f phos phate mo noes te rs: a biol ogic al pro blem with

m ultiple chemical solutions. Trends Biochem. Sci. 17:

105-110.

Wasaki, J., M. Omura, M. Ando, H. Dateki, T. S hinano, M.

Osaki, H. Ito, H. Matsui, and T. Tadano. 2000. Molecular

c loning and root specific expres sion of sec ret ory acid

phosphatase from phosphate deficient lupin (Lupinus albus

L.) Soil Sci. Plant Nutr. 46: 427-437.

Wasaki, J., M. Omura, M. Osaki, H. Ito, H. Matsui, T. Shinano,

a nd T. Ta dano. 1999. S tructure of a cDNA for an acid

phosphatase from phosphate-deficient lupin (Lupinus albus

L.) roots. Soil Sci. Plant Nutr. 45: 433-439.

Wei, Y.L., J.N. Li, J. Lu, Z.L. Tang, D.C. Pu, and Y.R. Chai.

2007. Molecular cloning of Brassica napus TRANSPARENT

TESTA 2 gene family encoding potential MYB regulatory

proteins of proanthocyanidin biosynthesis. Mol. Biol. Rep.

34: 105-120.

Xiao, K., M. Harrison, and Z .Y. Wang. 2006. Cloning and

characterization of a novel purple acid phos phatase gene

(MtPAP1) from Medicago truncatula Barrel Medic. J. Int.

Plant Biol. 48: 204-211.

Xu, B.B., J.N. Li, X.K. Zhang, R. Wang, L.L. Xie, and Y.R.

Chai. 2007. Cloning and molecular characterization of a

functional flavonoid 3��-hydroxylase gene from Brassica

napus. J. Plant Physiol. 164: 350-363.

Yang, G.Z., Y. Zhang, R.Q. Wang, Y.L. Yao, and Z. Song. 2007.

Study on high-yielding cultiva tion m odel for Brass ica

napus L. 12th International Rapeseed Congress, Wuhan,

China, Science Press USA Inc., pp. 18-21.

Yang, T.J., J.S. Kim, S.J. Kwon, K.B. Lim, B.S. Choi, J.A. Kim,

M. Jin, J.Y. Park, M.H. Lim, and H.I. Kim. 2006. Sequence-

level analysis of the diploidization process in the triplicated

FLOWERING LOCUS C region of Br ass ica rapa. Plant

Cell 18: 1339-1347.

Zhu, H., W. Qian, X. Lu, D. Li, X. Liu, K. Liu, and D. Wang.

2005. Expression patterns of purple acid phosphatase genes

in Arabidopsis organs and functional analysis of AtPAP23

predominantly transcribed in flower. Plant Mol. Biol. 59:

581-594.

Zimmermann, P., B. Regierer, J . Kos smann, E. Fross ard, N.

Amrhein, and M. Bucher, 2004. Differential expression

of three purple acid phosphatases from potato. Plant Biol.

(Stuttg). 6: 519-528.

pg_0015

LU et al. �X Rapeseed

PURPLE ACID PHOSPHATASE 17

genes

213