Botanical Studies (2009) 50: 181-192.

*

Corresponding author: E-mail: jhlin@dragon.nchu.edu.tw;

Tel: 886-4-22840416-518; Fax: 886-4-22874740.

INTRODUCTION

Because rice is the most important food in Asia,

improving its additive value will be of economical

significance. An effective approach toward this goal is the

introduction of economically beneficial gene(s) into rice

to produce useful proteins. Many exogenous genes have

already been introduced into transgenic rice plants for

producing useful foreign proteins. For example, two plant

genes from daffodil, phytoene synthase (psy) and lycopene

£]-cyclase (lcy), together with phytoene desaturase (crtl)

from the bacterial provitamin A biosynthesis pathway,

have been expressed in rice endosperm to improve the

nutritional value of the staple food, Golden Rice (Ye et al.,

2000).

Recently, high value recombinant proteins with

diagnostic, prophylactic or other potential applications

have been expressed in transgenic rice and shown to be

biologically active. Molecular farming of transglutaminase

(Capell et al., 2004), human £\1-antitrypsin (rAAT) (Trexler

Expression of Trigonopsis variabilis D-amino acid

oxidase in transgenic rice for cephalosporin production

Shih Yun LIN, Jiun Da WANG, and Jenq Horng LIN*

Department of Life Sciences, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 402, Taiwan

(Received May 1, 2008; Accepted October 16, 2008)

ABSTRACT.

Transgenic plants have become an effective system to produce recombinant proteins, and

there are many examples of transgenic plants that successfully produce functional proteins. In this study,

the japonica rice cultivar Taiken 9 was transformed through an Agrobacterium-mediated method to express

D-amino acid oxidase (DAAO) from Trigonopsis variabilis. DAAO is a flavoenzyme that catalyzes

the oxidation of cephalosporin C to produce the precursor of the cephalosporin antibiotic glutaryl-7-

aminocephalosporin acid (Gl-7-ACA). DAAO derived from T. variabilis has the highest catalytic activity for

cephalosporin C oxidation of DAAO enzymes that have been characterized. Trigonopsis daao was expressed

in rice under the control of either the rice actin 1 (Act1) or maize phosphoenolpyruvate carboxylase (PEPC)

promoter. Southern blot analysis demonstrated the integration of Trigonopsis daao gene into the rice genome.

Furthermore, northern blot and western blot analysis demonstrated production of the daao transcript and

accumulation of its protein in various tissues of transgenic rice plants using either the Act1 or PEPC promoter

as compared with the wild type. DAAO activity was detected in both transgenic rice lines with a maximum

specific activity of 65.5 ¡Ó 7.4 U mg protein

-1

min

-1

detected in the leaves of transgenic plants containing the

rice Act1 promoter. The transgenic rice plant with the rice Act1 promoter exhibited several fold higher DAAO

activity than the plant with the maize PEPC promoter: 5.3- and 3.7-fold higher in the leaves and sheaths,

respectively. No DAAO activity was detected in the grains of transgenic rice containing the PEPC promoter.

Taken together, these results demonstrate that Trigonopsis daao is stably integrated into the transgenic rice

genome, transcribed efficiently, and translated into a functional protein.

Keywords: Cephalosporin; D-amino acid oxidase; Japonica rice cultivar Taiken 9; Transgenic rice plant;

Trigonopsis variabilis.

et al., 2005) and lactoferrin (Conesa et al., 2007; Fuji-

yama et al., 2004) has been reported. Production of rice

containing the vaccine of multiple T-cell epitopes has

been proven feasible (Takagi et al., 2005; Takagi et al.,

2006). The advantages of using plant systems to produce

recombinant eukaryotic proteins are: fast growing,

low-cost, easy to scale-up, capable of posttranslational

modification, and little risk of bacterial or animal

pathogenic contamination (Kusnadi et al., 1997; De Wilde

et al., 2000; Daniell et al., 2001).

D-amino acid oxidase (DAAO, EC. 1.4.3.3) is an

industrial biocatalyst of 7-aminocephalosporanic acid

(7-ACA), an intermediate with high commercial value,

from which more than 50 semi-synthetic cephalosporin-

type antibiotics are produced (Fernandez-Lafuente

and Guisan, 1997; Suzuki et al., 2004). The industrial

conversion of cephalosporin C into 7-ACA involves

two reactions: the first reaction is catalyzed by DAAO

and the second is catalyzed by glutaryl-7-ACA acylase

(Pilone and Pollegioni, 2002). Although DAAO exists

ubiquitously in prokaryotes and eukaryotes, ranging from

yeasts to mammal cells (Kawamoto et al., 1977; Pistorius

and Voss, 1977; Rosenfeld and Leiter, 1977; Konno and

phySIOlOgy

182

Botanical Studies, Vol. 50, 2009

Yasumura, 1983; D¡¦Aniello et al., 1993), its bioconversion

capacity, in general, is not efficient and the best specific

activity of conversion is only 1 £gmol cephalosporin C

per minute per gram biomass of T. variabilis (Pilone and

Pollegioni, 2002). cDNA of T. variabilis DAAO was

also expressed in Escherichia coli by using lactose as an

inducer, the enzyme activity was up to 20.7 U mg protein

-1

min

-1

, and the expression level reached to 15% of total

soluble proteins (Hwang et al., 2000). The chimerical T.

variabilis DAAO accounted for 35% of the total soluble

in E. coli when fused with a 12-amino acids peptide at N

terminus (Dib et al., 2007; Pollegioni et al., 2008). Thus,

an economical solution to overcome this inefficiency is

to overexpress a large quantity of protein in transgenic

organisms.

Eriskon et al. (2004) have introduced Rhodotorula

graculis daao into Arabidopsis thaliana as a selectable

marker for transgenic plants. Using transgenic rice to

produce a large amount of DAAO protein is the long-

term goal of our study. The objective of this report is to

introduce the T. variabilis gene coding for DAAO into

japonica rice cultivar Taiken 9, a superior quality rice

variety, to produce DAAO with pharmaceutical value.

Rice does not contain the counterpart gene. Transformation

mediated by Agrobacterium was employed to overexpress

daao under the control of either the rice actin 1 promoter

( Act1) or the maize phosphoenolpyruvate carboxylase

( PEPC) promoter. The resulting transgenic rice plants

were subjected to Southern and northern analysis to detect

daao, and DAAO production was evaluated by western

blot and enzyme activity.

MATERIAlS AND METhODS

plant material and induction of embrogenic calli

Seeds of Oryza sativa L. cv. (Taiken 9) were generously

provided by the Rice Germplasm Center of Taichung

District Agricultural Research and Extension Station,

Council of Agriculture, Executive Yuan. To produce

calli, mature rice seeds were sterilized sequentially with

75% ethanol for 30 s and 2.5% sodium hypochlorite for

10 min, then rinsed three times with sterile water. After

removing the palea and lemma, seeds without the seed

coat were sterilized again with 75% ethanol for 30 s and

2.5% sodium hypochlorite for 30 min, washed three times

with sterile water, and finally cultured on N6D medium in

the dark with scutella pointing upward (Toki et al., 1997).

After 18-21 days, the primary calli (approximately 0.1 cm

in diameter) were separated from the scutella and used for

transformation.

preparation of constructs for plant

transformation

Two expression vectors with different promoters (Act1

and PEPC) to drive the expression of Trigonopsis daao

were used for Agrobacterium-mediated transformation.

pActdaaoHm2 (Figure 1D), an expression vector derived

Figure 1. Construction of the daao expression vector used

for t ransformation. (A) Diagram of the pdaaoGEMTeasy; (B)

Diagram of pPEPCdaaoBlueScript; (C) T he T-DNA region

of pHm 2 carrying the rice Act1 promoter; (D) The SalI/SacI

region of pHm2 was replaced by the XhoI/SacI fragment of

daao from pdaaoGEMTeasy to generate pActdaaoHm2. The

rice Act1 promoter was used to the daao gene expre ssion;

(E) The HindIII/SacI region of pHm 2 was replaced by the

fragment of PEPC-daao (the HindIII/SacI fragment, about

2.4 -kb) f rom pPEPCda aoBlueSc rpit (Figu re 1B) to yield

pPEPCdaa oHm 2. T he ma ize PE PC promoter was used to

the daao gene expression. RB and LB, right and left border

repeats, respectively; hpt, hygromycin-B-phosphotransferase

gene; npt II, neomycin phosphotransferase gene; nos, nopal-

ine synthase terminator.

LIN et al.

¡X

Trigonopsis variabilis

D-amino acid oxidase in transgenic rice

183

from pHm2 (Figure 1C), was a binary vector originating

from pBI101 bearing a rice Act1 promoter and hpt as a

plant selection marker and an nptII as a bacterial selection

marker. The HindIII/ SacI fragment of pHm2 was replaced

with Act1 fragment (the HindIII/SalI fragment, about

1.3-kb) from pHm2, combined the 1.1-kb daao-carrying

XhoI/SacI fragment from pdaaoGEMTeasy (Figure 1A)

which contained the Trigonopsis daao cDNA (Ju et al.,

1998). pPEPCdaaoHm2 (Figure 1E) was constructed from

pHm2 by inserting the PEPC-daao fragment (the HindIII/

SacI fragment, about 2.4-kb) of pPEPCdaaoBlueScript

(Figure 1B) into its HindIII/SacI site. The plasmid

pPEPCdaaoBlueScript was a derivative of pBlueScript

in which the HindIII/SacI site was replaced by the

1.1-kb BamHI/SacI daao fragment of pdaaoGEMTeasy

(Figure 1A) and by the 1.3-kb blunt-ended HindIII/ SmaI

PEPC fragment of pPEPC19 (Matsuoka et al., 1994).

PEPC is the promoter sequence of the maize C4-type

phosphoenolpyruvite carboxylase gene (Matsuoka et al.,

1989).

Rice transformation

The procedure for rice transformation was modi-

fied from that of Toki (1997). Transformation was

initiated by co-culturing the scutellum-derived calli

(3-weeks-old) from mature seeds with suspension

cultures of Agrobacterium tumefaciens carrying either

the pActdaaoHm2 or pPEPCdaaoHm2 vector. The

Agrobacterium suspension cultures were prepared

by adding 1 loop of bacteria into AAM-AS medium

and growing to an OD

600

0.8-1.0. The calli were then

immersed for 2 min in the culture supplemented with 10

mg/l acetosyringone, and cultured on N6-AS medium

(pH 5.2) for 3 days in the dark at 28¢XC. After 3 days, the

co-cultured calli were washed with N6D liquid medium

containing 500 mg/l carbenicillin to eliminate the bacteria,

and then transferred onto a solid N6D medium for

culture at 28¢XC for 2 weeks in the dark. Subsequently, the

transformed calli were transferred onto MS-NK medium

(Kyozuka and Shimamoto, 1991) containing 50 £gg/ml

hygromycin and 50 £gg/ml cefotaxime for regeneration

under a light/dark cycle of 8/16 h. The calli were subcul -

tured every 2 weeks until the appearance of green spots

on MS medium (Murashige and Skoog, 1962), which

were then incubated in sterile culture before transplanting

to pots in the greenhouse. At maturity, plants were self-

pollinated, and the resulting seeds (T

1

and T

2

) were

collected for further analysis.

Southern blot and northern blot analysis

Genomic DNA was isolated from leaves of T

0

and T

2

transgenic rice plants by the method previously described

(Cao et al., 1992). For Southern blot analysis, 30 £gg

genomic DNA of pActdaaoHm2 or pPEPCdaaoHm2

transgenic plants were digested with restriction enzymes

(SacI or XbaI for the former, and HindIII/SacI, or HindIII/

Xho I for the latter), separated by electrophoresis in a 1%

agarose gel, and transferred onto a nylon membrane by an

alkaline transfer method according to the manufacturer¡¦s

instructions (NEN

R

Life Science Products, Boston, MA,

USA). The membrane was subsequently hybridized

with a

32

p-labeled daao probe from pdaaoGEMTeasy (a

1.1-kb SacI fragment in Figure 1A), washed with 2%

SSC followed by 1% SDS at 65¢XC for 1 h, and exposed to

X-ray film. Southern blot analysis with T

2

transgenic rice

was repeated twice, and samples with a clear signal were

selected and combined for a composed figure.

For northern blot analysis, total RNA was extracted

from mature leaves and mRNA was subsequently isolated

using a commercial kit (Stratagene, Los Angeles, CA,

USA). mRNA (1 £gg) was separated by electrophoresis,

transferred on to a nylon membrane, probed with a

32

p-labeled daao probe from pdaaoGEMTeasy (a 1.1- kb

SacI fragment in Figure 1A), washed once with 2% SSC

followed by 1% SDS at 65¢XC three times, and exposed to

X-ray film.

RNA isolation and RT-pCR

Total RNA was isolated from 100 mg of leaf tissue

using Tri reagent according to the manufacturer¡¦s

instructions (Sigma, St. Louis, MO, USA). For RT-PCR

analysis, 2 £gg of total RNA was first reverse transcribed

using an oligo (dT) primer and M-MLV reverse

transcriptase (Promega, Madison, WI, USA). PCR was

subsequently carried out using one-tenth of the first-strand

reaction mix and gene-specific primers for daao: daao-1

(5¡¦-CCATGGCTAAAATCGTTGTT) and daao-2 (5¡¦-

GAGCTCCTAAAGGTTTGGACGAGCAAGG); Actin:

Rac48 (5¡¦-ATGCTATCCCTCGTCTCGAC) and Rac49

(5¡¦-TAGAAGCATTTCCTGTGCA). PCR conditions for

daao were 95¢XC for 120 s followed by 40 cycles of 95¢X

C for 30 s (denaturation), 55¢XC for 60 s (annealing), 72¢XC

for 60 s (elongation), and finally 72¢XC for 5 min. The PCR

program for Actin differed from the protocol in that the

annealing condition was 50¢XC for 60 s. Actin expression in

rice was as a control.

preparation of DAAO antibody

Anti-DAAO serum was generated in rabbits using

DAAO-His fusion protein produced by E. coli strain

BL21 bearing a DAAO-His-carrying expression

vector (pdaaomET32a

+

, Figure 7A) according to the

manufacturer ¡¦s instructions (Novagen, Milwaukee, WI,

USA). The bacterial culture in LB medium was incubated

at 37¢XC until the OD

600

reached 0.6, protein expression

was induced with 1 mM isopropylthio-£]-galactoside

(IPTG) and the incubation was continued at 16¢XC with

shaking for 8 h. After centrifugation of bacterial culture

at 8000 ¡Ñg for 10 min at 4¢XC, the pellet was suspended in

50 mM sodium phosphate buffer (pH 7) containing 300

mM NaCl, and then lysed with sonication. The extract was

clarified by centrifugation at 13000 ¡Ñg for 20 min at 4¢XC.

The fusion protein in the clear supernatants was purified

over BD TALON

TM

metal affinity resins according to the

184

Botanical Studies, Vol. 50, 2009

manufacturer¡¦s instructions (BD BioSciences, Palo Alto,

CA, USA).

To generate anti-DAAO serum, the DAAO-His fusion

protein was treated first with recombinant enterokinase

(Novagen), and the DAAO protein was separated by SDS-

PAGE. Purified DAAO protein (100 £gg) isolated by SDS-

PAGE was ground into fine powder, mixed with complete

Freund¡¦s adjuvant (1:1 [V:V] emulsion; Sigma), and

injected subcutaneously into an 8-week-old male New

Zealand rabbit. After 10 days, four additional injections

(100 £gg each; 7-d interval) with incomplete Freund¡¦s

adjuvant were administered. The serum was collected 2

days after the last injection for titer determination.

Western blot analysis

For protein western blot analysis of transgenic rice

plants, total leaf soluble protein was extracted from

transgenic plants by the method described (Outchkourov

et al., 2003). Briefly, leaves (about 200-300 mg) were

homogenized in 500 £gl extraction buffer (5 mM EDTA,

pH 7.5, 50 mM HEPES, pH 7.5, 10% glycerol, 10%

[W/V] polyvinylpolypyrrolidone, and 5 £gl protease

inhibitor cocktail [Sigma]), and the crude protein extract

was centrifuged twice for 10 min each at 13000 ¡Ñg and

4¢XC, and separated by SDS-PAGE. Proteins in the gel

were transferred onto a polyvinylidene fluoride membrane

and probed with anti-DAAO serum. Horseradish-

peroxidase-conjugated anti-rabbit antibodies (Jackson,

ImmunoResearch, West Grove, PA, USA) were used

as the secondary antibodies, and the Immobilon

TM

Western Chemiluminescent HRP Substrate (Millipore,

Watford, UK) was used for signal detection. Alkaline-

phosphatase-conjugated anti-rabbit antibodies (Jackson

ImmunoResearch, West Grove, PA, USA) were also used

as the secondary antibodies, and NBT/BCIP substrate

solution (Roche, Basal, Switzerland) was used for signal

detection.

DAAO activity assay

An assay of DAAO activity was conducted by

following the procedures described previously by Erikson

et al. (2004). The assay involved measurement of the

change in absorbance of pyruvate at 220 nm (£GE = 1,090

M

-1

cm

-1

) as the enzyme catalyzes the conversion of

D-alanine to pyruvate. To extract soluble protein for the

enzyme assay, 0.1 g fresh plant sample was pulverized and

mixed with 1 ml of 0.1 M potassium buffer (pH 8) before

being transferred to a 1.5-ml test tube. The crude extract

was cleared by centrifugation at 14000 ¡Ñg for 10 min and

the supernatant was used for the assay. To assay pyruvate,

80 £gl of crude extract was mixed with 2.12 ml of 0.1 M

potassium buffer (pH 8), and 100 £gl of 0.3 M D-alanine

and incubated for 2 h at 30¢XC. The reaction was stopped

by boiling for 10 min. The control reaction was the same

as above but without D-alanine. One unit (U) of DAAO

activity was defined as turnover of 1 nmol substrate per

min, and specific activity was expressed as units per

minigram protein of crude extract. Enzyme data presented

are means ¡Ó S.D. from 10 replications of sampling and

assay.

RESUlTS

production and phenotypic characteristics of

transgenic rice plants

Healthy calli (2-2.5 mm in diameter) were generated

from mature embryos of the rice cultivar Taiken 9 after

three weeks of induction (Figure 2A). After infection

with A. tumefaciens harboring the pActdaaoHm2

(Figure 1D) or pPEPCdaaoHm2 (Figure 1E) construct

carrying the Trigonopsis daao, the calli were incubated

on a cefotaxime- and hygromycin-containing selection

medium for two weeks in continuous darkness. To induce

the green spots from the calli, (Figure 2B and C), the

calli were then transferred to a regeneration medium

containing hygromycin under a light/dark cycle of 8/16

h. Calli containing green spots were further incubated on

MS medium containing hygromycin to induce shoot and

root formation (Figure 2D). Four plants were regenerated

from numerous calli; each was derived from a single

independent callus. Two of these carried the pActdaaoHm2

construct (Act:daao plants) whereas the other two plants

(PEPC:daao plants) carried the pPEPCdaaoHm2 construct.

The two Act:daao plants were designated A1 and A2 and

the two PEPC:daao plants P1 and P2.

The four plants (T

0

plants) were subsequently

transplanted to pots and grown in a greenhouse. Relative

to the wild type, these plants looked feeble, grew slowly

and had low fertility (except A2) and the seeds produced

had a lower germination rate. The two PEPC:daao plants

possessed distinctive characteristics: P1 had a short

stand and P2 had light green leaves. Grains produced

from the four T

0

plants were germinated and grown in

the greenhouse to obtain T

1

plants. All T

1

and wild type

plants developed poorly due to unexpected greenhouse

conditions and yielded few or no panicles except for

A2 and P1, which bore a sufficient number of grains.

Thus, A2 and P1 were selected for further physiological

characterization. Seedlings of the two plants were first

established in the greenhouse and then transplanted to the

field (T

2

plants). At maturity, the PEPC:daao plants (P1)

were considerably shorter (~50 cm) than the wild type

(~100 cm) and produced an average of 200 grains/plant as

compared to ~1000 grains/plant for the wild type (Figure

2F). In contrast, the Act:daao plants (A2) possessed plant

height and fertility similar to wild type (Figure 2E).

Molecular characterization

To determine the number of daao insertion site in the

rice genome, genomic DNA from the four T

0

plants and the

wild type were digested with SacI, XbaI, HindIII combined

with SacI, or HindIII combined with XhoI. DNA fragments

were separated and then probed with

32

P-labeled daao

cDNA. As shown in Figure 3A, no signal was evident for

LIN et al.

¡X

Trigonopsis variabilis

D-amino acid oxidase in transgenic rice

185

expected, as HindIII and SacI were used for cloning the

PEPC-daao fragment into the Ti plasmid, but XhoI was

not. The band sizes were different in P1 and P2 plants

when digested with Hind. and XhoI, which also indicated

different T-DNA integration locations in the rice genomes

of the PEPC:daao plants. Taken together, these Southern

blot results indicated a single daao integration site for A1

and P1 plants, but two or three for integration sites of A2

and P2 plants, respectively.

Further Southern analysis was performed with T

2

plants.

Genomic DNA was digested with SacI and HindIII/ SacI

in A2 and P1 plants, respectively. As shown in Figure 4,

16 A2 and 15 P1 plants were analyzed, and all exhibited a

single daao signal, indicating that the T

1

plants that gave

rise to these T

2

(A2 and P1) plants were likely carrying

the daao/daao genotype (likelihoods of -99% and 97.5-%,

respectively). In other words, homozygous lines for both

Act:daao and PEPC:daao plants were established for future

study.

Expression of daao transcript in transgenic rice

Northern blot hybridization with mRNA extracted from

leaves of both Act:daao and PEPC:daao plants (T

0

) was

performed to determine the transcriptional expression of

daao. As shown in Figure 5, a 1.1-kb signal was detected

in all Act:daao and PEPC:daao plants. Taking loading

variation into account, mRNA signals for the P1 and P2

plants were more intense than those of the A1 and A2

plants, indicating that the PEPC promoter outperformed

the Act1 promoter. Further analysis by RT-PCR also

detected stable daao expression in the T

2

generation of

Act:daao (A2) and PEPC:daao (P1) plants (Figure 6).

the wild type, and only a single major band appeared in the

SacI digest of A1 and A2 plants. However, the XbaI digest

of the same DNA from A2 gave rise to two bands, 6.5-kb

and 8.5-kb, but a single band of 9-kb for A1. Because

there was no internal XbaI restriction site in the T-DNA

of pActdaaoHm2, the size of the XbaI band associated

with A1or A2 could not be predicted. The band sizes were

different in the Act:daao plants, indicating that the two

Act:daao plants had different T-DNA integration locations

in the rice genomes. Similar results were observed in P1

and P2 (Figure 3B). For P2, only a single 2.4-kb band

was observed in the HindIII/ SacI digest, but three bands

(6.0-kb, 8.1-kb, and 24-kb) were presented in the Hind./

XhoI digest. The equivalent P1 digests displayed only a

single band with a fragments size of 2.4-kb (HindIII/SacI)

and 9.2-kb (Hind./XhoI), respectively. This result was

F igure 2. Calli and plants resulting from Agrobacterium-

me diat ed t ra nsform ati on. (A) Embr yoge nic cal li derived

from ma ture kernels for th re e wee ks; (B) a nd (C)

Hygromycin-resistant calli on a regeneration medium plus

hygrom ycin. Gree n spots on som e c all i a re indic ate d by

arrows; (D) Shoots growing from the green spots were trans-

ferred to MS medium plus hygromycin; (E) Transgenic rice

(T

2

) with pActdaaoHm 2 compared with wild type grown in

the field. (F) Transgenic rice (T

2

) with pPEPCdaaoHm2 com-

pared with wild type grown in the field. W T, wild type.

Fi gure 3. Autoradiogram of Southern hybridization of

genom ic DNA isolate d from wild type a nd transgenic ric e

pla nt s (T

0

) t ransfor med eithe r with pActda aoHm 2 (A) or

pPEPCda aoHm 2 (B). The genom ic DNA of pAc tdaaoHm 2

a nd pPEPCdaa oHm 2 t ransge nic plant s was digested with

restriction enzymes and probed with the daao fragment of

pdaaoGEMTeasy. WT, wild type; A1, and A2, pActdaaoHm2

t ra nsgenic plants; P1, and P2, pPEPCda aoHm 2 t ra nsgenic

plants; S, SacI, X, XbaI for pActdaaoHm2; H, HindIII and S,

SacI or X, XhoI for pPEPCdaaoHm 2.

186

Botanical Studies, Vol. 50, 2009

Expression of DAAO protein and enzyme

activity in the transgenic plants

To detect the accumulation of DAAO protein in

transgenic rice plants, an antiserum against purified DAAO

was produced in rabbits. After induction recombinant

protein (DAAO-His fusion protein) was synthesized using

an overexpression system in E. coli strain BL21 carrying

a DAO-His-containing pET32a

+

expression vector (Figure

7A). The recombinant DAAO-His protein was purified

from a bacterial lysate using a metal affinity column

(Figure 7B) before injection into a rabbit. As shown in

Figure 7C, the rabbit anti-DAAO serum displayed affinity

for the recombinant DAAO-His protein produced by E.

coli.

Total soluble proteins extracted from leaves, sheaths

and grains from the homozygous T

2

transgenic (daao/

daao) and wild type plants were subjected to western

immunoblot analysis. As shown in Figure 8, no DAAO

signal was observed in the wild type. In contrast, a 39-kDa

polypeptide corresponding to DAAO was detected in the

leaf and sheath of both transgenic (T

2

) plants (A2, P1).

We consistently observed that the accumulation of DAAO

protein in all tissues was more pronounced in Act:daao

plants than in PEPC:daao plants (A2 and P1, Figure 8).

To test if the DAAO protein detected by western blot

was functional, DAAO activity was measured in leaves,

sheaths and grains of A2 and P1 (T

2

) plants. As shown in

Table 1, the three tissues of the wild type plant showed no

DAAO activity, but those of A2 and P1 exhibited various

levels of activity. The DAAO activity in Act:daao plants

exceeded that in PEPC:DAAO plants by 5.3-fold in leaves

and by 3.7-fold in sheaths. Although no activity was

measured in the grains of PEPC:daao plants, substantial

activity (22.4 U mg protein

-1

min

-1

) was detected in the

same tissue of Act:daao plants. In general, the specific

activity of DAAO in both transgenic rice plants was

highest in leaves, followed by sheaths and grains.

Figure 6. RT-PCR analysis of daao expression of transgenic

pla nt s (T

2

). Tot al R NA was extrac ted from wild ty pe and

transgenic rice plants. (A) daao transcription of t ransgenic

pActda aoHm 2 plants; (B) daao t ra nscription of transgenic

pPEPCdaaoHm2 plants. WT, wild type; A2, transgenic pAct-

daa oHm 2 pla nt s; P1, tra nsge nic pPE PCd aa oHm2 plant s.

Actin (Act) levels were analyzed in all samples.

Figure 5. Northern blot analysis of daao expression in wild

t ype a nd transgenic rice plants. Total RNA was extrac ted

from wild ty pe and several t ransgenic lines (lower panel),

blot ted and hybridized with the daao probe (upper panel).

WT, wil d t y pe; P1 a nd P2 , pPEPCda a oHm2 tr an sge ni c

plants; A1 and A2, pActdaaoHm 2 transgenic plants.

Table 1. DAAO activity in different tissues of wild type and T

2

transgenic rice plants.

Genotype

Leaf Sheath Grain

Act:daao plant (A2) 65.5 ¡Ó 7.4

a

34.3 ¡Ó 6.8 22.4 ¡Ó 7.9

PEPC:daao plant (P1) 12.3 ¡Ó 2.5 9.3 ¡Ó 1.7 0

Wild type

0

0

0

a

The unit of DAAO activity is expressed as U mg protein

-1

min

-1

.

Fi gure 4. Autoradiogram of Southern hybridization of

g eno mic DNA isol at ed fr om wi ld t y pe an d tr ansgeni c

r ic e pla nt s (T

2

) tr an sfor med wi th ei th er pAct da ao Hm2

(A) or pPEPCdaaoHm2 (B). Genomic DNA wa s dige st-

ed w ith either SacI (p Actdaao Hm 2) or HindIII/SacI

(pPEPC daaoHm 2) a nd probed with the daao fra gment of

pdaaoGemteasy. WT, wild type; lanes 1-16, different trans-

genic plants.

LIN et al.

¡X

Trigonopsis variabilis

D-amino acid oxidase in transgenic rice

187

DISCUSSION

In this study, the daao gene of T. variabilis was

successfully introduced into the japonica rice cultivar

Taiken 9 via Agrobacterium-mediated transformation.

This gene was not only transcribed but also translated into

functional protein in transgenic rice plants. Substantial

activities of DAAO were observed in the leaf, sheath,

and grain of transgenic plants containing the rice Act1

promoter and in the leaf and sheath of transgenic plant

containing the maize PEPC promoter. As expected, no

DAAO activity was detected in the wild type plants.

From the limited number of transgenic plants obtained,

it appears the rice Act1 promoter can drive a higher level

of Trigonopsis daao gene expression than the maize

PEPC promoter. However, a larger number of transgenic

plants for each line are needed for analysis before a clear

conclusion regarding the strength of the two promoters can

be drawn.

The PEPC:daao plants (P1) were shorter than the wild

type; in contrast, the Act:daao plants (A2) possessed plant

height and fertility similar to wild type (Figure 2E and F).

Fig ure 7. Recombinant DAAO-His protein purification and

det ect ion wit h ant i-His ant ibody a nd ant i-DAAO ser um .

(A) Diagram of pdaaomET32a

+

; (B) Recom bi nant DAAO

protein was over-expressed in E. coli, purified with a Talon

metal affinity column, separated by SDS-PAGE and stained

with Coom assie blue. M, protein marker; lane 1, soluble pro-

tein of bacterium culture after 1 mM IPTG induced; lane 2,

recombi nant DAAO-His protein eluted with 1 M im idazole

from Talon metal affinity column. Arrow indicates the over-

expressed prote in (55-kDa); (C) Weste rn blot a nalysis of

recom binant DAAO. La ne 1, anti-His antibody. La nes 2-5,

various tit ers of anti-DAAO seru m, t he tit ers are 1:1000,

1:2500, 1:5000, 1:10000, respect ively. Arrow indicates the

recombinant DAAO protein (55-kDa).

Fi gur e 8. Western blot of DAAO in leaves, sheaths and

grains. Total protein was extracted from wild type and trans-

genic plants (T

2

). Uppe r panel s, DAAO detected by rabbit

a nti-DAAO ser um i n leaves (A) in sheaths (B) and gra ins

(C ). W T, wild type; P1, pPEPCdaaoHm2 transgenic plants;

A2, pActdaaoHm 2 transgenic plants. Lower panel, the ribu-

lose 1,5-bisphosphate carboxylase/oxygenase ( Rubisco) pro-

teins stained with Coomassie blue in leaves (A) and sheaths

(B); total proteins stained with Coomassie blue in grains (C);

Arrow indicates the position of DAAO (39-kDa).

188

Botanical Studies, Vol. 50, 2009

The phenotypic variation of the PEPC:daao plants may be

due to the T-DNA insertion site, and not attributed to daao

gene expression, because the phenotype of the Act:daao

plants, which also expressed daao, was the same as wild

type plants.

The japonica rice cultivar Taiken 9 was used for the

gene transformation because of the high quality of its rice.

Our goal is to further increase the value of this superior

rice by insertion of daao. Over 1000 calli were derived

from Taiken 9 by transformation with pActdaaoHm2

or pPEPCdaaoHm2, but only two successful transgenic

rice plants containing each plasmid were generated from

these calli. The regeneration rate of Taiken 9 transgenic

rice plants was very low, so we generated only four

transformants of the T

0

generation. Those plasmids with

daao in transgenic plants maybe existed low expression

or didn¡¦t express which result to transgenic rice plants

can¡¦t grow well on the hygromycin selection regeneration

medium. The low regeneration rate for daao transgenic

rice plants wasn¡¦t due to the DAAO toxic in plants,

because the daao transgenic A. thaliana grew well

(Eriskon et al., 2004), and the next generation (T

2

) o f

DAAO transgenic rice plants also developed well.

As an important pharmaceutical product, DAAO

efficiently catalyzes the bioconversion of cephalosporin C

to Gl-7-ACA, the first intermediate in the two-step route

from cephalosporin C to 7-ACA (Pilone and Pollegioni,

2002). Therefore, improvement in DAAO¡¦s stability,

enzyme activity and yield is vital for the pharmaceutical

industry. Ju et al. (2000) has substituted the critical

methionine residues of DAAO from T. variabilis with

leucine to enhance its resistance to hydrogen peroxide.

Horner et al. (1996) added D- and DL-amino acid

derivatives to minimal medium to improve DAAO yield in

T. variabilis. DAAO is normally produced by fermentation

by T. variabilis (Horner et al., 1996; Gabler et al., 2000)

or E. coli (Alonso et al., 1999). Although fermentative

production of DAAO can reach a significant level for

pharmaceutical industrial scale, the specific activity was

2 fold lower than that obtained in shaking flasks of T.

variabilis (Pilone and Pollegioni, 2002). In this study,

the Trigonopsis daao was introduced into rice with the

objective of exploiting the plant system as a bioreactor for

large-scale production of DAAO. Using a plant system

for production of recombinant proteins is advantageous,

as they can be generated in large scale much more eco-

nomically than by fermentation or by using E. coli as a

bioreactor.

The level of daao expression in the transgenic plants

was probably not on the number of integrated daao copies

in the chromosome(s) in our study (Figure 5). The P1

plants contained a single integrated daao copy, but its

daao RNA accumulation was higher than the P2 plants that

carried two daao copies. Our result is in agreement with

that of Law et al. (2004), who found that the copy number

of a humanized monoclonal antibody ( mAb) gene in the

transgenic maize genome is not proportional to the amount

of protein produced. The same situation was also noted for

the expression of a mosaic green fluorescent protein (gfp)

in tobacco, in which multiple insertions of gfp rendered

variable protein production (Bastar et al., 2004). Other

has observed that the expression of a transgene gene is

often proportional to the number and genomic position

of integrated genes (Meyer and Saedler, 1996; Ku et al.,

1999). It is conceivable that the variable level of transgene

expression in the P1 and P2 plants may be attributable

to divergence in the chromosome position of the daao

integration sites, which were not determined in this study.

Alternatively, it may be the result of silencing of some

of the multiple daao insertions in the plant, as has been

observed for other transgenes (Cheng et al., 1998; Matzke

et al., 1995).

Two promoters (Act1 and PEPC) were used in this

experiment to drive the expression of Trigonopsis

daao in rice, and both promoters have been previously

demonstrated to be effective in many transgenic plants.

The Act1 promoter of rice is an effective regulator of

foreign gene expression in transgenic rice (McElory et

al., 1990; Zhang et al., 1991; Su and Wu, 2004). The

maize PEPC promoter from C4-type phosphoenolpyruvite

carboxylase has been introduced into rice, a C

3

plant,

where it was successfully translated in a light-dependent

manner into the expected product in mesophyll cells of

leaf blades and sheaths (Hausler et al., 2002; Matsuoka et

al., 1994). Gel-retardation assay have consistently shown

that nuclear proteins with DNA-binding specificity similar

to maize nuclear proteins are present in rice (Matsuoka et

al., 1994; Taniguchi et al., 2000), which would permit the

maize PEPC promoter to function properly in rice.

The levels of DAAO expression differed between the

two transgenic plants with the two different promoters.

The activity of DAAO in the Act:daao plant surpassed that

in the PEPC:daao plant (Table 1). The DAAO activities

in these transgenic plants were consistent with the DAAO

content as determined by western blot analysis (Figure 8).

More DAAO accumulated in the leaf and sheath of Act:

daao plant than in PEPC:daao plant. However, DAAO was

not detect in the grain of PEPC:daao plant (Figure 8C).

This is expected because the maize C

4

-specific PEPC gene

promoter is light-dependent. The low DAAO activities

found in the PEPC:daao plant (Table 1), however, the

northern blot (Figure 5) and the RT-PCR (Figure 6) did

not show any sign of decreased transcription level in

PEPC:daao plant. The mention above condition may be

attribute to the low mass of DAAO proteins production in

transgenic PEPC:daao plants could be result of instability

or miss-folding of the yeast proteins in the transgenic rice

cells to cause low enzyme activities. Another probable

reason could be a bias in codon usuage between yeast

and rice plants, which would cause a low efficiency of

translation of the mRNA coding for the foreign protein

(Mason et al., 1980). Integration position effect of daao in

the rice genome was also maybe influenced transcription

of the transgene and thus accumulation and activity of

LIN et al.

¡X

Trigonopsis variabilis

D-amino acid oxidase in transgenic rice

189

the DAAO protein. Similar results were reported by De

Neve et al. (1999) regarding the gene that encodes the

F

ab

antibody polypeptide; different integration positions

in the genome of transgenic A. thaliana led to instability

of antibody production, and contributed to low antibody

accumulation in transgenic plants.

The DAAO activity presented in Table 1 were

compared with Eriskon¡¦s (2004) study, although the goal

of the Eriskon study was use to DAAO as a selectable

marker for transgenic plants. They introduced the R.

graculis daao gene into A. thaliana and discerned high

DAAO activity, which was calculated on a fresh-weight

(g) basis. In our study, the specific activity of DAAO was

expressed in term of a protein weight (mg) in the crude

extract. Therefore, it is difficult to compare the expression

levels achieved in transgenic A. thaliana (Eriskon et al.,

2004) with those in the transgenic rice in the present study.

Comparing the DAAO specific activities of transgenic

rice plant were deeply lower than of overexpressing in

E. coli. According to Hwang¡¦s (2000) study, in lactose-

induced E. coli BL21, the enzyme activities from

expressed His6-tagged DAAO were reached to 20.7 U mg

protein

-1

min

-1

. Dib et al. (2007) used IPTG as an inducer

to elevate Trigonopsis DAAO amount in E. coli, and the

enzyme activities were for up to 58 U mg protein

-1

min

-1

.

One unit (U) of DAAO activity was defined as the amount

of the enzyme for producing 1 £gmol substrate per min in E.

coli, however, in our study, one unit (U) of DAAO activity

was defined as turnover of 1 nmol substrate per min. The

best DAAO activities in transgenic rice of Act:daao plants

were only 65.5 U mg protein

-1

min

-1

, which were shown

lower 316-886 folds than that in E. coli.

The ultimate objective of this study is to be able to

extract a large quantity of DAAO from transgenic rice for

pharmaceutical uses. Our present study demonstrated that

it is feasible to produce DAAO in transgenic rice plants.

Enhancement of promoter strength to achieve even higher

expression to maximize enzyme is our next effort. For

example, the sugar response sequence (SRS) of £\-amylase

gene can be integrated in the Act1 promoter for increasing

the promoter expression (Chen et al., 2002). Acquisition of

more transgenic rice plants for screening a high expression

line is underway. It is important for industrial application

to maximize enzyme yield in transgenic plants to achieve

large-scale production. For the application of DAAO from

transgenic rice plants to industrial scale, extraction of

the DAAO protein from the transformants crude extract

through DAAO antibody-affinity column is a desirable

method (Hashimoto and Komastu, 2007). Alternatively,

using Berg¡¦s method (1976) to purify DAAO from

transgenic plants may be another possibility, which by

precipitating protein with acetone and ammonium sulfate,

and applying gel and ion-exchange chromatography to

purify protein further.

Acknowledgements. The authors gratefully thank

Dr. W.H. Hsu (Institute of Molecular Biology, Nation

Chung Hsing University, Taiwan, ROC) for providing

the DAAO gene from T. variabilis and Dr. M. Matsuoka

(BioScience Center, Nogoya University, Japan) for

preparing the pHm2 and pPEPC19 constructs. We also

appreciate the suggestion and comments of Dr. B.Y. Lin

(Institute of Molecular Biology, Nation Chung Hsing

University, Taiwan, ROC) and Dr. M.S.B. Ku (Department

of BioAgricultural Science, National Chiayi University,

Taiwan, ROC) on early versions of this manuscript.

lITERATURE CITED

Alonso, J ., J. L. Barredo, P. Armisen, B. Diez, F. Salto, J.M.

Guis an, J .L. Garcia, and E. Cortes . 1999. Engineering

the D-amino acid oxidase from Trigonopsis variabilis to

facilitate its overexpres sion in E scherichia coli and its

downstream processing by tailor-made chelate support.

Enzyme Microb. Technol. 25: 88-95.

Ba st ar, M. T., Z . L utha r, S . Skof, a nd B. Bohane c. 2004.

Quantiative determination of mosaic GFP gene expression

in tobacco. Plant Cell Rep. 22: 939-944.

Berg, C.P. and F.A. Rodden. 1976. Purification of D-amino acid

oxidas e from Trigonopsis variabilis. Anal. Biochem. 71:

214-222.

Cao, J., X. Duan, D. McElory, and R. Wu. 1992 Regeneration

of herbicide-resis tant transgenic rice plants followi ng

m icroprojectile-media ted transformation of s uspens ion

culture cells. Plant Cell Rep. 11: 586-591.

Capell, T., I. Claparols, S. Del-Duca, L. Bassie, B. Miro, J.

Rodriguez -Monte sinos , P. Chris ton, and D. S erafi na-

Fracassin. 2004. Producing transglutaminase by molecular

farming in plants : minireview article. Amino Acid 26:

419-423.

Cheng, W., J. Su, B. Zhu, T.L. Jayaprakash, and R. Wu. 1998.

Development of transgenic c ere al crop plants that are

tolerant to high salt, drought and low temperature. In C.H.

Chou and K.T. S hao (eds.), Frontiers in Biology: T he

challenges of biodiversity, Biotechnology and S uitable

Agriculture Academia Sinica, Taipei, pp. 115-122.

Chen, P.W., C.A. Lu, T.S. Yu, T.H. Tseng, C.H. Wang, and S.M.

Yu. 2002. Rice £\-Amylase transcriptional enhancers direct

multiple mode regularion of promoters in transgenic rice. J.

Biol. Chem. 277: 13641-13649.

Cones a, C., L. S anchez, M.D. Perez , and M. Calvo. 2007.

Acalormetric study of denaturation of recombinant hunain

lactoferrin from rice. J. Agric. Food Chem. 55: 4858-4853.

Daniell, H., S.J. S treatfield, and K. Wycoff. 2001. Medical

m o l e c u l a r f a r m i n g : p ro d u c t i o n o f a n t i b o d i e s ,

biopharmaceuticals and edible vaccines in plants. Trends

Plant Sci. 6: 219-226.

D¡¦Aniello, A., G. D¡¦Onofrio, M. Pischetola, G. D¡¦Aniello, A.

Vetero, L. Petruelli , and G.H. Fisher. 1993. Biological role

of D-amino acid oxidase and D-aspartate oxidase. J. Biol.

Chem. 268: 26941-26949.

De Neve , M., S . De Buc k, C. De Wilde , H. Va n Houdt, I.

190

Botanical Studies, Vol. 50, 2009

Strobbe, A. Jacobs, M. Van Montagu, and A. Depicker.

1999. Gene s ilencing res ult s in instability of antibody

production in transgenic plants. Mol. Gen. Genet. 260:

582-592.

De Wilde, C., H. Van Houdt, S. De Buck, G. Angenon, G. De

Jaeger, and A. Depicker. 2000. P lants as bioreactor for

protein production: avoiding the proble m of transgene

silencing. Plant Mol. Biol. 43: 347-359.

Dib, I., D. Stanzer, and B. Nidetzky. 2007. Trigonopsis

variabilis D-amino acid oxidase: control of protein quality

and opportunities for biocatalysis through production in

Escherichia coli. Appl. Environ. Microbiol. 73: 331-333.

Eriskon, O., M. Hertzberg, and T. Nasholm. 2004. A conditional

marker gene allowing both positive and negative selection

in plants. Nat. Biotechnol. 22: 455-458.

Fernandez-Lafuente, R., and J.M. Guisan. 1997.

C he m o e n z ym a t i c o n e -p ot s y nt h e s i s of c e f a z ol i n

cephalosporin C in fully aqueous medium, involving three

consec utive biotrans formations catalyzed by D-a mino

acid oxidase, glutaryl acylase and penicillin G acylas e.

Tetrahedron Lett. 38: 4693-4696.

Fujiyama, K., Y. Sakai, R. Misaki, I. Yanaghihara, T. Honda,

H. Anzai, and T. Seki. 2004. N-linked glycan structures

of humain lactoferrin produced by transgenic rice. Biosci.

Biotechnol. Biochem. 68: 2565-2570.

Gabler, M., M. Hensel, and L. Fischer. 2000. Detection and

s ubs trat e s ele cti vity of new mi crobi al D-a min o aci d

oxidase. Enzyme Microb. Technol 27: 605-611.

Hashimoto, M. and S. Komastu. 2007. Proteomic analysis of rice

seedlings during cold stress. Proteomics 7: 1293-1302.

Hausler, R.E., H.J . Hirsch, F. Kreuzaler, and C. Peterhansel.

2002. Overexpression of C

4

-cycle enzymes in transgenic

C

3

plants: a biotechnological approach to improve C

3

-

photosynthesis. J. Exp. Bot. 53: 591-607.

Horner, R., F. Wagner, and L. Fischer. 1996. Induction of the

D-amino acid oxidase from Trigonopsis var iabilis. Appl.

Environ. Microbiol. 62: 2106-2110.

Hwang, T.S., H.M. Fu, L.L. Lin, and W.H. Hsu. 2000. High-level

expression of Trigonopsis variabilis D-amino acid oxidase

in Escherichia coli using lactose as inducer. Biotechnol.

Lett. 14: 195-200.

Ju, S.S., L.L. Lin, W.C. Wang, and W.H. Hsu. 1998. A conserved

aspirate is essential for FAD binding and catalysis in the

D-amino acid oxidase from Trigonopsis variabilis. FEBS

Lett. 436: 119-122.

Ju, S.S., L.L. Lin, S.R. Chien, and W.H. Hsu. 2000. Substitution

of the critical methionine residues in Trigonopsis variabilis

D-amino acid oxidase with leucine enhances its resistance

to hydrogen peroxide. FEMS Microbiol. Lett. 186: 215-219.

Kawamoto, S., A. Tanaka, M. Yamamura, Y. Teranishi, and S.

Fukui. 1977. Microbody of n-alkane-grown yeast. Enzyme

localization in the isolated microbody. Arch. Microbiol.

112: 1-8.

Konno, R. and Y. Yasumura. 1983. Mouse mutant difficient in

D-amino acid oxidase activity. Genetics 103: 277-285.

Ku, M.S.B., S. Agarie, M. Nomura, H. Fukayama, H. Tsuchida,

K. Ono, S. Hirose, S. Toki, M. Miyao, and M. Matsuoka.

1999. High-level expression of maize phosphoenolpyruvate

caeboxylase in transgenic rice plants. Nat. Biotechnol. 12:

76-81.

Kusnadi, A.R., Z.L. Nikolov, and J.A. Howard. 1997. Production

of recombinant proteins in transgenic plants: practical

considerations. Biotechnol. Bioeng. 56: 473-484.

Kyozuka , J . and K. Shima moto. 1991. Tra ns formation and

regeneration of rice protoplasts. In K. Lindsey (ed.), Plant

Tis sue Culture Manual: fundamentals and applications .

Kluwer Academic, Dordrecht, pp. B2 1-17.

Law, R.D., D.A. Russ ell, L.C. Thompson, S.C. Sc hroeder,

C.M. Middle, M.T. Tremaine, T.P. Jury, X. Delannay, and

S.C. Slater. 2004. Biochemical limitation of to high-level

expression of humanized monoclonal antibody in transgenic

m aize see d e ndosperm. Biochim. Biophys. Acta 1760:

1434-1444.

Matsuoka, M., J. Kyozuka, K. Shimamoto, and Y. Kano-

Murakami. 1994. The promoters of two carboxylase in C

4

plant (maize) direct cell-specific, light-regulated expression

in a C

3

plant (rice). Plant J. 6: 311-319.

Matsuoka, M. and E. Minami. 1989. Complete structure of the

gene for phosphoenolpyruvate carboxylase from maize. Eur.

J. Biochem. 181: 593-598.

Mat zke , M.A. and A.J.M. Matzke. 1995. How and why do

plants inactive homologous transgenes. Plant Physiol. 107:

679-685.

McElroy, D., W. Zhang, J. Cao, and R. Wu. 1990. Isolation of an

efficient actin promoter for use in rice transformation. Plant

Cell 2: 163-171.

Meyer, P. and H. Saedler. 1996. Homologous dependent genes

silencing in plants. Annu. Rev. Plant Physiol. Plant Mol.

Biol. 47: 23-48.

Mason, H.S., T.A. Haq, J.D. Clements, and C.J. Arntzen. 1980.

Vaccine protects mice against Escherichia coli heat-labile

enterotoxin (LT): potatoes expressing a s ynthetic LT-B

gene. Vaccine 16: 1336-43.

Murashige, T. and F. Skoog. 1962. A revised medium for rapid

growth and bioassays with tobacco tissue cultures. Physiol

Plant 18: 100-127.

Outchkourov, N.S., B. Rogelj, B. Strukelj, and M.A. Jongsma.

2003. Expression of sea anemone equistatin in potato effects

of plant protease on heterologous protein production. Plant

Physiol. 133: 379-390.

Pilone, M.S. and L. Pollegioni. 2002. D-amino acid oxidase as

an industrial biocatalyst. Biocatal. Biotrans formation 20:

145-159.

Pistorius, E.K. and H. Voss. 1977. A D-amino acid oxidase from

Chlorella vulgaris. Biochim. Biophys. Acta 481: 395-406.

Pollegioni, L., G. Molla, S . S acchi, E. Rosini, R. Verga, and

M.S. Pilone. 2008. Properties and applications of microbial

D-amino acid oxidase: current state and perspectives. Appl.

LIN et al.

¡X

Trigonopsis variabilis

D-amino acid oxidase in transgenic rice

191

Microbiol. Biotechnol. 78: 1-16.

Rosenfeld, M.G., and E.H. Leiter. 1977. Isolation and

characterization of a mitochondrial D-amino acid oxidase

from Neurospora crassa. Can. J. Biochem. 55: 66-74.

Su, J., and R. Wu. 2004. Stress-inducible synthesis of proline in

transgenic rice confers faster growth under stress conditions

than that with constitutive synthesis. Plant Sci. 166:

941-948.

Suzuki, H., C. Miwa, S. Ishihara, and H. Kumagai.

2 00 4 . A s i n g le a m i n o a c id s ub s t i t u ti o n c o nv e rt s

£^-glutam yltrans peptida se t o a clas s IV cepha losporin

acylase (glutaryl-7-aminocephalosporanic acid acylase).

Appl. Environ. Microbiol. 70: 6324-6328.

Taniguchi, M., K. Izawa, M.S.B. Ku, J .H. Lin, H. S aito, Y.

Ishida, S. Ohta, T. Komari, M. Matsuoka, and T. Sugiyama.

2000. Binding of c ell type-specific nuc le ar proteins to

the 5¡¦-flanking region of maize C4 phosphoenolpyruvate

carboxylase gene confers its differential transcription in

mesophyll cells. Plant Mol. Biol. 44: 543-557.

Takagi, H., T. Hiroi, L. Yang, Y. Tada, Y. Yuki, K. Takamura,

R. Ishimitsu, H. Kawauchi, H. Kiyono, and F. Takaiwa.

2005. A rice-based edible vaccine expressing multiple T

cell epitopes induces oral tolerance for inhibition of Th2-

mediated IgE responses. Proc. Natl. Acad. Sci. USA 102:

17525-17530.

Takagi, H., S. Hirose, H. Yasuda, and F. Takaiwa. 2006.

Biochemical s afety evaluation of trans genic rice s eeds

ex pres s ing T ce ll e pit ope s o f J apa nes e ced ar po lle n

allergens. J. Agric. Food Chem. 54: 9901-9905.

Toki, S. 1997. Rapid and efficient Agrobacterium-mediated

transformation in rice. Plant Mol. Biol. Rep. 15: 16-21.

Trexle r, M.M., K.A. McDonald, a nd A.P. J ac kman. 2005.

Acyclical s emicontinuous process for production of human

£\1-anti tryps in us ing met abolica lly induced pla nt cell

suspension cultures. Biotechnol. Prog. 21: 321-328.

Ye. X, S. Al-Babili, A. Kloti, J. Zhang, P. Lucca, P. Beyer, and I.

Potrykus. 2000. Engineering the provitamin A (£]-Carotene)

biosynthetic pathway into (Carotenoid-free) rice endosperm.

Science 287: 303-305.

Zhang, W., D. McElroy, and R. Wu. 1991. Analysis of rice Act1

5¡¦ region activity in transgenic rice plants. Plant Cell 3:

1155-1165.

192

Botanical Studies, Vol. 50, 2009