Bot. Bull. Acad. Sin. (2000) 41: 1-10

Cheng and Yeh — In vivo expression of PRSV CP genes with different leaders

Construction and evaluation of transgenic tobacco plants

expressing the coat protein gene of papaya ringspot virus

with different translation leaders

Ying-Huey Cheng¹ and Shyi-Dong Yeh^2,3

¹Department of Horticulture, Taiwan Agricultural Research Institute, Wufeng, Taiwan, Republic of China

²Department of Plant Pathology, National Chung Hsing University, Taichung, Taiwan, Republic of China

(Received August 19, 1998; Accepted June 5, 1999)

Abstract. Papaya ringspot virus (PRSV) YK isolate used in this study is a local mosaic strain isolated from Yung-Kang, Tainan, and its genome has been cloned and completely sequenced. A NcoI site before the coat protein (CP) reading frame of PRSV YK was generated by oligonucleotide-directed mutagenesis, and then the CP reading frame with the 3' noncoding region of PRSV YK was ligated with the gus leader sequence from the pGEM vector to create the construct pGGCP. To express the CP with a homologous viral translation sequence, the gus leader was replaced by the cDNA sequence corresponding to the 5' region (nt 1-347) of PRSV genome to generate a protein containing 9 kDa polypeptide of PRSV P1 protein fused with the CP, and the construct was designated as pG5'CP. In vitro translation from the transcripts derived from pGGCP and pG5'CP generated protein products of 36 kDa and 45 kDa, respectively. Both proteins reacted with the antiserum to PRSV CP, and the level of 36 kDa protein was higher than that of 45 kDa protein. The CP reading frame with the gus or PRSV 5' leaders was individually subcloned into a Ti binary vector. Transgenic tobacco plants (Nicotiana tabacum L. Havana 423) expressing the PRSV CP gene with the gus leader (GCP lines) or with the viral leader (5'CP lines) were obtained by Agrobacterium-mediated transformation. When the transgenic lines were analyzed by western blotting, the protein products of 36 kDa and 45 kDa reacting to PRSV CP antiserum were detected in the GCP lines and 5'CP lines, respectively. The presence of the CP gene in the transgenic tobacco was also confirmed by polymerase chain reaction (PCR) using primers specific to the CP gene. Analysis of segregation ratios in the R₁ plants of four GCP lines and four 5'CP lines indicated that the CP gene in all of them was nuclearly inherited as a single dominant trait. R₀ and R₁ plants of the four GCP lines and four 5'CP lines were inoculated with tobacco etch virus (TEV), potato virus Y (PVY), or pepper mottle virus (PepMoV). The transgenic lines showed significant delay in symptom development and the severity of symptoms was attenuated. The GCP lines expressing the PRSV CP gene by the gus leader accumulated higher levels of CP and showed higher degrees of resistance than the 5'CP lines with the PRSV 5' leader. Our results indicate that the homologous viral leader does not enhance CP expression either in vitro or in vivo, nor does it provide better resistance in transgenic tobacco.

Keywords: Coat protein gene; Papaya ringspot virus; Potyvirus; Translation leader.

Introduction

Transgenic plants expressing the coat protein (CP) of a plant virus have been proved resistant to infection by the same or related viruses. The first illustration of CP-mediated resistance was reported by Powell-Abel et al. (1986). In that study the CP gene of tobacco mosaic virus (TMV) was transferred to tobacco, and symptom development was delayed in the transgenic plants when challenged with TMV. Since then, there have been numerous reports demonstrating that transgenic plants with viral CP genes are resistant to virus infection (Beachy et

al., 1990; Fitchen and Beachy, 1993). The level of resistance ranged from delay of symptom development to immunity, and the spectrum of resistance to viruses ranged from narrow to broad. The CP-mediated protection has provided an innovative method for control of plant viruses.

Papaya ringspot virus (PRSV) is a member of the genus Potyvirus, the largest group of plant viruses (Reichmann et al., 1992). Gene expression and genetic organization of the virus have been characterized previously (Yeh and Gonsalves, 1985; Yeh et al., 1992). The genome of PRSV contains one large ORF, which encodes a polyprotein of 383 kDa that is proteolytically processed into functional proteins. The destructive papaya ringspot disease caused by the virus is the major factor limiting the wide-scale planting of this fruit tree throughout papaya

³Corresponding author. Tel: 04-2877021; Fax: 04-2877585; E-mail: sdyeh@nchu.edu.tw

Botanical Bulletin of Academia Sinica, Vol. 41, 2000

growing areas (Purcifull et al., 1984). In the late 1970’s, PRSV spread throughout Taiwan island and destroyed most of its commercial papaya orchards (Wang et al., 1978). In Taiwan, two major strains of PRSV, the mosaic and wilting types, were found, with the mosaic considered to be the most prevailing (Chang, 1979). The CP gene of a typical mosaic strain PRSV YK isolated from Yung-Kang, Tainan county, has been sequenced and compared with other strains of PRSV from different geographic origins (Wang et al., 1994). The CP of PRSV is not translated in its final form but processed from the C-terminal part of the polyprotein (Yeh et al., 1992). Therefore, no initiation codon or leader sequence for translation exists in front of the CP reading frame. For potyviral CP genes to be functional in plant cells, a leader sequence and an initiation codon must be added for efficient translation and a promoter and a terminator are needed for efficient transcription.

The CP genes of several potyviruses have been transferred to plants with various leaders from plant viruses or other sources. For example, the leader of the nos gene was constructed with the CP gene of bean yellow mosaic virus (BYMV) (Hammond and Kamo, 1993); the leader of gus gene with CP genes of plum pox virus (PPV) (Ravelonandro et al., 1992) and passionfruit woodiness virus (PWV) (Yeh and Chu, 1996); the leader of alfalfa mosaic virus (AlMV) RNA 4 with the CP gene of tobacco vein mottling virus (TVMV) (Maiti et al., 1993); the leader of tobacco mosaic virus (TMV) with the CP gene of lettuce mosaic virus (LMV) (Dinant et al., 1993); the leader of potato virus X (PVX) with the CP gene of potato virus Y (PVY) (Hefferon et al., 1997); the leader of cucumber mosaic virus (CMV) RNA 4 with the CP genes of PRSV (Ling et al., 1991; Fitch et al., 1992), watermelon mosaic virus II (WMV II), and zucchini yellow mosaic virus (ZYMV) (Namba et al., 1992); the leader of tobacco etch virus (TEV) with the CP genes of TEV (Lindbo and Dougherty, 1992) and peanut stripe virus (PStV) (Cassidy and Nelson, 1995). In these reports, CP transgenic plants showed various degrees of resistance to homologous and heterologous potyvirus infection. Comparison between the amino acid sequences of the CPs of several potyviruses revealed that distinct viruses share an average sequence identity of 54% (Shukla and Ward, 1989). The broad resistance to infection by heterologous potyviruses may be due to their high homology in the CP sequence.

In this study, the leader sequence from the gus reporter gene and the PRSV 5' leader sequence were fused with the PRSV YK CP reading frame to express the gene in plant cells and compare their resistance to potyviral infection in transgenic tobacco plants. These two constructs of the CP gene were introduced into the Ti-binary vector, in which they were flanked with a CaMV 35S promoter and a nos terminator for expression in plant cells. Transgenic tobacco plants expressing the constructed CP genes were generated by Agrobacterium-mediated transformation, and their resistance to infection by heterologous potyviruses was evaluated under greenhouse conditions.

Materials and Methods

Plant Materials

Seeds of tobacco (Nicotiana tabacum L. Havana 423) were surface sterilized by being submerged in 0.1% hypochloride for 30 min and placed on 2% water agar for germination. The plantlets were grown on Murashige and Skoog (MS) medium (Murashige and Skoog, 1962). Leaves from the cultured tobacco plants were used for transformation.

Construction of PRSV CP Gene

Construction of PRSV CP genes with different translation leaders is summarized in Figure 1. Plasmid pYKD9—containing most of the NIb gene, the complete CP gene, and the entire 3' noncoding region of the genome of a severe mosaic type strain from Taiwan, PRSV YK—was obtained from previous studies (Wang et al., 1994). Plasmid pBI121, containing the npt II and the gus genes, was purchased from Clontech (Palo Alto, California). The gus gene was moved from pBI121 to the pGEM vector (Promega, Madison, Wisconsin) by SmaI and SacI digestion, generating a plasmid pGGUS. The NcoI site was introduced into pGGUS and pTMD9 by in vitro mutagenesis (Taylor et al., 1985 a&b) at the site immediately before the gus and CP reading frames, respectively. The NcoI/SacI fragment of the mutagenized pTMD9 was introduced into the mutagenized pGGUS, resulting in a substitution of the gus ORF by the PRSV CP reading frame with its 3' noncoding region. The plasmid containing the CP gene with a gus leader was designated as pGGCP. The constructed CP gene with the gus leader was introduced into pBI121 (Clontech) by SmaI/SacI replacement to generate plasmid pBGCP in the Ti vector. The CP gene in pBGCP was flanked with a CaMV 35S promoter and a nos terminator for transcription in plant cells (Figure 1).

In contrast to the gus leader, the 5' leader from PRSV was also used for translation of the CP gene. The nucleotide sequence of the 5' end of PRSV HA strain was previously determined by direct RNA sequencing (Yeh et al., 1992). The cDNA clone corresponding to the 5' end region (nucleotide 1-977) of PRSV HA strain (Yeh et al., 1992) was amplified by polymerase chain reaction (PCR) and cloned into the pBluescript II vector (Stratagene, La Jolla, California). The obtained clone in pHA 1.0 contained 1 kb of the 5' end region of PRSV. A different construct of the CP gene was generated by substituting the gus leader sequence with the 5' end region (nt 1-347) of PRSV by XbaI and NcoI digestion, resulting in a plasmid pG5'CP which contained the complete viral leader sequence and the 87 amino acids of the N-terminal part of P₁ protein of PRSV (Yeh et al., 1992) in frame with the CP reading frame. The PRSV CP gene containing the homologous virus leader sequence was transferred to pBI121 by SmaI/SacI replacement in pBI121 vector and designated as pB5'CP (Figure 1).

The two plasmids containing the CP genes, pBGCP and pB5'CP, were mobilized to disarmed Agrobacterium

Cheng and Yeh — In vivo expression of PRSV CP genes with different leaders

Figure 1. Construction of PRSV YK CP gene for expression in plant cells. The gus gene in pBI121 was introduced to pGEM vector to generate pGGUS. In vitro mutagenesis was performed to create a NcoI site before the gus and CP reading frames in pGGUS and pTMD9, respectively. The gus reading frame was substituted by the CP reading frame to generate plasmid pGGCP by NcoI/SacI digestion. The gus leader before the CP reading frame was replaced with the PRSV 5' leader from pHA1.0, which contained a cDNA fragment corresponding to the 5' region (nt 1-347) of PRSV RNA, by XbaI and NcoI digestion to generate pG5'CP. Two constructs of the CP gene were subcloned in Ti vector pBI121 by substituting the gus gene to generate pBGCP and pB5'CP, in which the CP gene was flanked by a CaMV 35S promoter and a nos terminator and coupled with the selection marker npt II gene within the T-DNA borders. The resulting plasmids pBGCP and pB5'CP were introduced to Agrobacterium tumefaciens LBA4404 by triparental mating and used for plant transformation.

tumefaciens LBA4404 by the triparental mating method (Rogers et al., 1986). Agrobacterium tumefaciens cells cultured in the LB medium containing 50 mg/l kanamycin and 100 mg/l streptomycin at 28°C for 36 h were used for plant transformation.

In vitro Expression of the CP Gene

To verify the construction, the constructs pGGCP and pG5'CP containing the entire CP reading frame with a gus leader and a PRSV 5' leader, respectively, were analyzed by in vitro transcription, in vitro translation, and immunoprecipitation. RNA transcripts were synthesized by run-off transcription using T7 RNA polymerase according to the manufacturer’s directions (Stratagene). Approxi

mately 1 µg of linearized DNA templates were used for in vitro transcription. The resulting RNA transcripts were dissolved in 25 µl of RNase-free double distilled water and used for in vitro translation.

Ten µl of transcription products were used in the rabbit reticulocyte translation system and in vitro translation was performed as described by the user’s manual (Stratagene). The products of in vitro translation were labeled with [³⁵S]methionine and analyzed by immunoprecipitation with the antiserum to PRSV CP (Yeh et al., 1984) following the procedure described by Dougherty and Hiebert (1980). In vitro translation and immunoprecipitated proteins were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) followed by autoradiography.

Botanical Bulletin of Academia Sinica, Vol. 41, 2000

Plant Transformation

Agrobacterium-mediated transformation using leaf disks of tobacco was performed as described by Rogers et al. (1986). Transformants were selected by MS104 medium (MS basal medium containing 1 ppm BA and 0.1 ppm NAA) containing 300 ppm kanamycin. The shoots regenerated from calli were rooted on the MS medium containing 150 ppm kanamycin. The established plantlets were maintained in a greenhouse for further analyses.

DNA Extraction and Polymerase Chain Reaction

The presence of PRSV CP gene in the putative transgenic tobacco plants was detected by PCR using primers specific to the CP gene. Total DNAs of the putative transgenic plants or non-transformed plants were extracted following the procedure described by Mettler (1987). One µg of RNase A-treated DNA was used for PCR as template. The upstream primer HA92, ^5'TTCCATGG CGTCCAAGA ATGAAGCT^3', and the downstream primer HA99, ^5'AGCGCTGCAGCCTTCATCTG^3', which reflect nucleotide positions 9256-9271 and 9974-9993 of the PRSV YK sequence (Wang and Yeh, 1997), respectively, were used for amplification. The PCR was performed with periods of 1 min for melting at 94°C, 2 min for annealing at 55°C, and 3 min for synthesis at 72°C for 30 cycles (Saiki et al., 1988). PCR products were analyzed by electrophoresis in 1% agarose gels.

Western Blot Analysis

The expression of the CP in the transgenic tobacco was analyzed by western blotting using the antiserum to PRSV CP (Yeh et al., 1984) as the primary antibody and goat anti-rabbit IgG conjugated with alkaline phosphatase (Jackson, West Grove, PA) as the secondary antibody. Leaf tissues from three youngest leaves of each putative transgenic plant were homogenized in 4 volume (w/v) of dissociation buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 3% 2-mercaptoethanol, 10% glycerol, 0.005% bromophenol blue). The extracts were heated at 95°C for 5 min and centrifuged at 8,000 g for 3 min for removing plant debris. Total protein of each sample (15 µl) was loaded on 12% gels and separated by SDS-PAGE (Laemmli, 1970), and subsequently transferred to PVDF membranes (Millipore, Bedford, MA). The immunostaining procedure was performed as described by the GUS Gene Fusion System user’s manual (Clontech).

Inheritance Analysis of the R₁ Progeny of the PRSV CP Transgenic Plants

The selected transgenic tobacco R₀ lines expressing the PRSV CP gene were maintained in greenhouse and self-fertilized to generate R₁ seeds. The progenies of transgenic lines containing the CP gene were screened by kanamycin-resistance provided by the nptII gene which was co-transferred with the CP gene. Seeds of R₁ transgenic tobacco were surface sterilized and placed on 2% water agar for 4 days in the dark for germination. The germi

nated plantlets were cultured on the MS medium containing 150 ppm kanamycin. The surviving green plantlets were transferred to soil and grown under greenhouse conditions.

Resistance Evaluation of the Transgenic Plants

Subcloned R₀ plants, R₁ progenies of transgenic lines expressing the PRSV CP gene, and nontransformant controls at the stage of 5-6 leaves were mechanically inoculated with 1:20 (w/v) dilution of inocula of TEV, PVY and PepMoV (all provided by R. Provvidenti, Cornell University), which were prepared from leaves of virus-infected tobacco in 0.01 M potassium phosphate buffer (pH 7.0), on two fully expanded leaves of each plant. Each inoculum was also applied onto leaves of local lesion host Chenopodium quinoa Wild. The inoculated plants were kept in a greenhouse (20-35°C) and development of symptoms were recorded daily after inoculation.

Results

In vitro Expression of the CP Gene

Protein expression of constructs pGCP and pG5'CP were analyzed using in vitro translation and immunoprecipitation, and results are shown in Figure 2. A 36 kDa protein was the major product when the transcript derived from pGGCP was used as template, and a major protein of 45 kDa was detected when the transcript derived from pG5'CP was used as template. A 46 kDa protein expressed from endogenous mRNA did not react with the antiserum. Both 36 kDa and 45 kDa proteins were immunoprecipitated with antiserum to PRSV CP. A minor 36 kDa protein was also detected when the transcript from pG5'CP was used for translation. This protein also reacted well with the antiserum to PRSV CP and was considered as the protein translated from the second AUG present in the joining NcoI site. The second initiation codon would result in a protein reflecting the entire reading frame of the

Figure 2. Immunoprecipitation and in vitro translation analyses of transcripts from pGGCP and pG5'CP by SDS-PAGE and autoradiography. The transcripts from pGGCP and pG5'CP were translated in rabbit reticulocyte lysate and ³⁵S-labeled protein products were immunoprecipitated with the antiserum to PRSV CP.

Cheng and Yeh — In vivo expression of PRSV CP genes with different leaders

CP, the same as that generated from the gus leader. The results of in vitro translation verified that the two types of leader sequences and the initiation codon were correctly constructed for expression of PRSV YK CP reading frame. Also, the gus leader appeared to have higher translation efficiency than the PRSV leader in vitro.

Expression of the PRSV CP Gene in Transgenic Tobacco Lines

The putative transgenic plants expressing the CP gene from the gus leader were designated as GCP lines and those from the PRSV 5' leader were designated as 5'CP lines. PCR analysis using primers specific to PRSV CP gene amplified the expected 0.73 kb DNA fragment from four putative GCP transgenic lines GCP-4, GCP-14, GCP-15, and GCP-33; and four putative 5'CP transgenic lines 5'CP-1, 5'CP-2, 5'CP-3, and 5'CP-4 (Figure 3). This fragment was not detected in non-transformant controls (Figure 3).

Western blot analysis was used to examine the expression of PRSV CP in putative transgenic plant lines. A 36 kDa protein was detected in plant lines GCP-4, GCP-14, GCP-15 and GCP-33 (Figure 4A). The 36 kDa protein was co-migrated with the CP from PRSV infected Cucumis metuliferus (Figure 4A). A 45 kDa protein was detected in transgenic plant lines 5'CP-1 and 5'CP-4 (Figure 4B), 5'CP-2 and 5'CP-3 (data not shown). The 45 kDa protein reacted with antiserum to PRSV CP but in far smaller amounts than the 36 kDa protein from GCP lines (Figure 4A and B). The 36 kDa and 45 kDa proteins detected by the PRSV CP antiserum were not detected in non-transformant controls (Figure 4A and B).

Inheritance and Segregation of the CP Gene in the R₁ Progeny of the Transgenic Lines

The segregation ratios of R₁ progenies (resistant vs. susceptible to kanamycin) of the transgenic lines GCP-4, GCP-14, GCP-15, GCP-33, 5'CP-1, 5'CP-2, 5'CP-3 and 5'CP-4 fitted the 3:1 ratio for a single dominant trait (Table 1).

Seeds of R₂ progeny from transgenic lines GCP-4, GCP-15 and 5'CP-4 were obtained by self-fertilization of R₁ plants in greenhouse. Homozygous plants of R₁ progeny were determined by germination of R₂ seeds in the MS medium containing kanamycin. All the R₂ plants derived from a R₁ plant showing resistance to kanamycin represented homozygosity of the CP gene.

Evaluation of Transgenic Plant Lines Inoculated with TEV, PepMoV, and PVY

The inocula of each potyvirus used contained high concentrations of active virions, for 80-130 local lesions per leaf of inoculated C. quinoa were recorded. When the non-transformed plants were inoculated with TEV, they showed symptoms which consisted of prominent vein clearing and severe mottling on systemically infected leaves 8-9 days after inoculation. The infected plants were stunted and leaves with severe symptoms were generally smaller than healthy plants. R₁ plants of transgenic lines GCP-4, GCP-14, GCP-15, GCP-33, 5'CP-1, 5'CP-2, 5'CP-3 and 5'CP-4 showed attenuated symptoms 2-3 weeks after in

Figure 3. PCR analysis of PRSV YK CP transgenic tobacco plants (Nicotiana tobacum Havana). Total DNAs were extracted from leaf tissues of putative transgenic lines or an untransformed tobacco plant. PRSV CP-specific primers were used for amplification. The PRSV CP-specific DNA fragment of 0.73 kb is indicated.

Table 1. Segregation ratios of the R₁ progenies from the PRSV YK CP transgenic tobacco lines, which carried the CP gene of PRSV YK with the gus leader sequence (GCP lines) or the PRSV 5'-viral leader sequence (5'CP lines), as determined by the assay for resistance to kanamycin.

Plant lines Number of R₁ seedlings c² (3:1) p^a

Kanamycin-resistant Kanamycin-susceptible

GCP-4 37 6 1.170 0.3-0.4

GCP-14 34 11 0.008 0.9-1.0

GCP-15 32 11 0.009 0.9-1.0

GCP-33 34 13 0.177 0.7-0.8

5'CP-1 19 6 0.013 0.9-1.0

5'CP-2 37 12 0.008 0.9-1.0

5'CP-3 31 13 0.530 0.5-0.6

5'CP-4 34 12 0.029 0.9-1.0

^aProbability of goodness of fit was set at a significant level of 0.05.

Botanical Bulletin of Academia Sinica, Vol. 41, 2000

Figure 4. Western blot analysis of PRSV YK CP transgenic tobacco plants (Nicotiana tobacum Havana). Total protein extracted from leaves of plantlets of putative transgenic lines were separated by SDS-PAGE and immunoblotted with the antiserum to PRSV CP. Putative transgenic lines with PRSV YK CP gene expressed from the gus leader were shown in panel A, and those expressed from the homologous virus 5' leader were shown in panel B.

oculation (Table 2). In R₁ plants of line GCP-15, symptom development was significantly delayed in 3 out of 10 inoculated plants, and the other 7 plants remained symptomless for a test period of 42 days (Table 2). The growth of these plants was similar to that of the healthy controls (Figure 5).

When inoculated with PVY and PepMoV, R₁ plants of GCP and 5'CP lines delayed symptom development for 15-21 days compared to the controls (Tables 3 and 4, respectively). Most of the infected transgenic plants recovered, and newly developed leaves were symptomless. Growth of virus-infected plants in transgenic lines were less affected than the infected non-transformant controls. Plants of line GCP-15 showed the most significant resistance to PVY and PepMoV compared with other transgenic lines, with most of the plants remaining symptomless for a test period of 35 days (Tables 3 and 4). A few plants of line GCP-4 and 5'CP-4 remained symptomless to PepMoV infection (Table 4), indicating these two lines also had a relatively high level of resistance to PepMoV.

Since R₀ plants of each line were obtained at different times, only 2-4 plants were tested for their resistance to infection by TEV, PVY and PepMoV. A similar delay in symptom development and attenuation in symptom severity were observed in both R₀ (data not shown) and R₁ plants. Among them, the R₀ plants of line GCP-15 had a greater resistance than R₀ plants of other lines.

Discussion

The CP gene of PRSV YK was constructed for expression in plant cells by adding a 35S promoter, a leader sequence, an initiation codon and a nos terminator. Two types of leader sequences, the leader from the commercial gus reporter gene and the PRSV 5' leader, were introduced

Figure 5. Resistance to tobacco etch virus (TEV) conferred by PRV YK CP transgenic tobacco plants. A: Left, untransformed tobacco plants inoculated with TEV; middle, plants of transgenic line GCP-15 inoculated with TEV; right, untransformed tobacco plants mock-inoculated with buffer. B: Close-up of individual plants of A. The photos were taken one month after inoculation.

Cheng and Yeh — In vivo expression of PRSV CP genes with different leaders

Table 2. Evaluation of transgenic tobacco lines, which carried the CP gene of PRSV YK with the gus leader sequence (GCP lines) or the PRSV 5'-viral leader sequence (5'CP lines), against TEV infection as determined by symptom development under greenhouse conditions.

Plant lines^b No. of plants showing symptom at DPI^a

7 14 21 28 35 42

Untransformed 0 10 10 10 10 10

GCP-14 0 8 10 10 10 10

GCP-33 0 7 10 10 10 10

GCP-4 0 1 3 3 4 10

GCP-15 0 0 0 0 2 3

5'CP-1 0 5 8 10 10 10

5'CP-2 0 2 10 10 10 10

5'CP-3 0 10 10 10 10 10

5'CP-4 0 0 10 10 10 10

^aDPI: days post inoculation.

^bR₁ progenies of GCP and 5'CP transgenic lines were used for inoculation. Ten plants of each transgenic line or untransformed control at the stage of 7-15 cm tall were mechanically inoculated with TEV using a 1:20 dilution (w/v) of TEV-infected tobacco tissue as inoculum.

Table 3. Evaluation of transgenic tobacco lines, which carried the CP gene of PRSV YK with the gus leader sequence (GCP lines) or the PRSV 5'-viral leader sequence (5'CP lines), against PVY infection as determined by symptom development under greenhouse conditions.

Plant lines^b No. of plants showing symptom at DPI^a

7 14 21 28 35 42

Untransformed 0 0 10 10 10 10

GCP-14 0 0 0 10 10 10

GCP-33 0 0 0 0 10 10

GCP-4 0 0 0 2 4 10

GCP-15 0 0 0 0 2 2

5'CP-1 0 0 0 8 10 10

5'CP-2 0 0 6 10 10 10

5'CP-3 0 0 2 10 10 10

5'CP-4 0 0 0 6 10 10

^a,bThe growth stage of plants and the preparation of inoculum were similar to those in Table 2. Ten plants of each line were used for inoculation.

Table 4. Evaluation of transgenic tobacco lines, which carried the CP gene of PRSV YK with the gus leader sequence (GCP lines) or the PRSV 5'-viral leader sequence (5'CP lines), against PepMoV infection as determined by symptom development under greenhouse conditions.

Plant lines^b No. of plants showing symptom at DPI^a

7 14 21 28 35 42

Untransformed 0 0 0 10 10 10

GCP-14 0 0 0 2 3 10

GCP-33 0 0 0 3 5 10

GCP-4 0 0 0 0 1 4

GCP-15 0 0 0 0 1 5

5'CP-1 0 0 0 0 8 10

5'CP-2 0 0 0 0 6 10

5'CP-3 0 0 0 0 10 10

5'CP-4 0 0 0 0 4 8

^a,bThe growth stage of plants and the preparation of inoculum were similar to those in Table 2. Ten plants of each line were used for inoculation.

Botanical Bulletin of Academia Sinica, Vol. 41, 2000

in frame with the CP gene in this study. The ability to generate the correct CP in the two constructs was verified by in vitro transcription, translation, and immunoprecipitation. Accumulation of the CP expressed by the gus leader in calli and leaves of the transgenic plant lines was detectable by western blot analysis. However, in transgenic lines expressing the CP by the PRSV 5' leader, accumulation of CP was below detectable level except in the plantlet stage (data not shown). The different quantity of the CP between transgenic lines containing the gus leader and the PRSV leader may be due to different translational efficiencies in plant cells. Also, it might be due to the different stability of proteins based on size, conformation, or modified N-terminal structure of CP products.

When the resistance of four GCP lines and four 5'CP lines was evaluated under high concentrations of inoculum, GCP-15 showed a high level of resistance. The other three lines, GCP-4, GCP-14 and GCP-33 showed lower levels of resistance as four lines of 5'CP transgenic plants. These results were consistent with the previous reports for PRSV (Ling et al., 1991), LMV (Dinant et al., 1993), and PVY (Hefferon et al., 1997), in which plants accumulating detectable or higher levels of the CP showed higher degrees of resistance to virus infection. The results were in contrast to the observations made by Stark and Beachy in SMV (1989) and Namba et al. (1992) in WMV II and ZYMV, in which they showed that transgenic plants exhibiting the greatest protection against infection did not contain the highest level of the CP. These latter observations may explain some discrepancies in our results, such as the failure of the relatively high expressor GCP-14 to show a high level of resistance and a low expressor GCP-33 which did show a good level of resistance. However, both expression levels of CP and degrees of resistance of these two lines are lower than GCP-15.

The transgenic lines with the 5' leader did not significantly enhance resistance because symptom development was delayed as with the gus leader. Ling et al. (1991) constructed the PRSV CP gene with a leader sequence of CMV RNA 4, but these CP transgenic plants were not resistant to infection by CMV, indicating that the presence of a heterologous viral leader sequence does not confer resistance. This phenomenon was also found in PStV CP transgenic plants with TEV leader (Cassidy and Nelson, 1995) and PVY CP transgenic plants with PVX leader (Hefferon et al., 1997). In this study, the homologous viral leader sequence was used for expression of PRSV CP, but its expression levels were generally lower than the gus leader both in vitro (Figure 2) and in vivo (Figure 4 A and B). The broad spectrum resistance was highly dosage dependent. The PRSV 5' leader possibly exhibited lower degrees of resistance since resistance became insignificant when plants were inoculated with higher inoculum dosages (data not shown). In the 5' leader construct, the CP was fused with 87 amino acids of the N-terminal end of P₁ protein. Whether this sequence affects the expression and the resistance provided by the CP sequence needs to be further investigated.

The heterologous CP-mediated protection generally showed lower levels of resistance than homologous CP-mediated protection (Fitchen and Beachy, 1993), and the resistance was usually displayed as a delay of symptom development. Since tobacco is not a host plant for PRSV, the resistance to the homologous virus could not be tested. Protection conferred by heterologous CP sequences has been shown in potyviruses (Stark and Beachy, 1989; Ling et al., 1991) and tobamoviruses (Nejidat and Beachy, 1990). It was suggested that approximately 60% homology in the CP amino acid sequence was sufficient to confer significant structural similarity to provide protection against related viruses (Stark and Beachy, 1989). Although the first 42 nts of the 5' terminus of the genomic RNA of PRSV showed 80% similarity with those of TEV and PVY (Yeh et al., 1992), the 5'CP transgenic plants did not express a high level of resistance to these viruses.

R₀ subcloned plants and R₁ plants of transgenic tobacco lines were evaluated for broad spectrum resistance, and they showed similar levels of it, indicating that the resistance conferred by the CP gene was inherited as a nuclear trait. Ling et al. (1991) showed that the hemizygosity of the PRSV CP gene in R₁ transgenic tobacco resulted in a shorter delay in symptom development. Their observation was similar to the transgenic tobacco plants expressing the CP gene of WMV II or ZYMV that were resistant to infection by two other potyviruses (Namba et al., 1992). Stark and Beachy (1989) also showed that plants with homozygosity for expression of the SMV CP were more resistant to TEV infection. The different degrees of resistance between hemizygous and homozygous plants were not observed in R₁ plants in this investigation (data not shown), possibly due to levels of inocula which were 5 to 25 times higher than in other studies, as compared by the local lesion assay on C. quinoa.

In this study, two constructs of PRSV CP gene, containing the gus leader or the homologous PRSV 5' leader, were transferred into transgenic tobacco. The transgenic lines exhibited broad spectrum resistance to heterologous potyviruses in delaying symptom development and in attenuation of symptom severity. Transgenic line GCP-15, which carried the CP gene with the gus leader, showed a relatively higher level of resistance to infection by the challenge viruses. These two constructs will be transferred to papaya and the ability of CP-mediated resistance against PRSV infection in its natural host papaya will be investigated.

Acknowledgment. This study was supported in part by the Council of Agriculture and the National Science Council of the Republic of China.

Literature Cited

Beachy, R.N., S. Loesch-Fries, and N.E. Tumer. 1990. Coat protein-mediated resistance against virusinfection. Annu. Rev. Phytopath. 28: 452-474.

Cassidy, B.G. and R.S. Nelson. 1995. Differences in protection phenotypes in tobacco plants expressing coat protein genes

Cheng and Yeh — In vivo expression of PRSV CP genes with different leaders

Powell-Abel, P., R.S. Nelson, B. De, N. Hoffman, S.G. Rogers, R.T. Fraley, and R.N. Beachy. 1986. Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232: 738-743.

Purcifull, D.E., J.R. Edwardson, E. Hiebert, and D. Gonsalves. 1984. Papaya Ringspot Virus. CMI/AAB Descriptions of Plant Viruses, No. 84.

Ravelonandro, M., M. Monsion, P.-Y. Teycheney, P.R. Delbos, and J. Dunez. 1992. Transgenic tobacco plants that contain the plum pox virus (PPV) coat protein gene. Acta Hort. 309: 191-196.

Reichmann, J.L., S. Lain, and J.A. Garcia. 1992. Highlights and prospects of potyvirus molecular biology. J. Gen. Virol. 73: 1-16.

Rogers, S.G., R.B. Horsch, and R.T. Fraley. 1986. Gene transfer in plants: Production of transformed plants using Ti-plasmid vectors. Methods Enzymol. 118: 627-640.

Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, and H.A. Erlich. 1988. Primer-directed amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491.

Shukla, D.D. and C.W. Ward. 1989. Identification and classification of potyviruses on the basis of coat protein sequence data and serology. Arch. Virol. 106: 171-200.

Stark, D.M. and R.N. Beachy. 1989. Protection against potyvirus infection in transgenic plants: Evidence for broad spectrum resistance. Bio/Technology 7: 1257-1262.

Taylor, J.W., J. Ott, and F. Eckstein. 1985a. The rapid generation of oligonucleotide- directed mutations at high frequency using phosphorothioate-modified DNA. Nucleic Acids Res. 13: 8765-8774.

Taylor, J.W., W. Schmidt, R. Cosstick, A. Odruszed, and F. Eckstein. 1985b. The use of phosphorothioate-modified DNA in restriction enzyme reaction to prepare nicked DNA. Nucleic Acids Res. 13: 8749-8764.

Wang, C.-H., H.-J. Bau, and S.-D. Yeh. 1994. Comparison of the nuclear inclusion B protein and coat protein genes of five papaya ringspot virus strains distinct in geographic origin and pathogenicity. Phytopathology 84: 1025-1210.

Wang, C.-H. and S-D. Yeh. 1997. Divergence and conservation of the genomic RNAs of Taiwan and Hawaii strains of papaya ringspot potyvirus. Arch. Virol. 142: 271-285.

Wang, H.-L., C.-C. Wang, R.-J. Chiu, and M.-H. Sun. 1978. Preliminary study on papaya ringspot virus in Taiwan. Plant Prot. Bull. (Taiwan) 20: 133-140.

Yeh, S.-D. and D. Gonsalves. 1985. Translation of papaya ringspot virus RNA in vitro: detection of a possible polyprotein that is processed for capsid protein, cylindrical-inclusion protein, and amorphous-inclusion protein. Virology 143: 260-271.

Yeh, S.-D., D. Gonsalves, and R. Provvidenti. 1984. Comparative studies on host range and serology of papaya ringspot virus and watermelon mosaic virus 1. Phytopathology 74: 1081-1085.

Yeh, S.-D. and F.-H. Chu. 1996. Production and evaluation of transgenic tobacco plants expressing the coat protein gene of passionfruit woodiness virus. Bot. Bull. Acad. Sin. 37: 181-190.

Yeh, S.-D., F.-J. Jan, C.-H. Chiang, T.-J. Doong, M.-C. Chen, P.-H. Chung, and H.-J. Bau. 1992. Complete nucleotide sequence and genetic organization of papaya ringspot virus RNA. J. Gen. Virol. 73: 2531-2541.

from peanut stripe potyvirus with or without an engineered ATG. Mol. Plant-Microbe Interact. 8: 357-365.

Chang, C.A. 1979. Isolation and comparison of two isolates of papaya ringspot in Taiwan. J. Agric. Res. China 28: 207-216.

Dinant, S., F. Blaise, C. Kusiak, S. Astier-Manifacier, and J. Albouy. 1993. Heterologous resistance to potato virus Y in transgenic tobacco plants expressing the coat protein gene of lettuce mosaic potyvirus. Phytopathology 83: 818-824.

Dougherty, W.G. and E. Hiebert. 1980. Translation of potyvirus RNA in a rabbit reticulocyte lysate: Cell-free translation strategy and a genetic map of the potyviral genome. Virology 104: 183-194.

Fitch, M.M.M., R.M. Manshardt, D. Gonsalves, J.L. Slightom, and J.C. Sandford. 1992. Virus resistant papaya plants derived from tissues bombarded with the coat protein gene of papaya ringspot virus. Bio/Technology 10: 1466-1472.

Fitchen, J.H. and R.N. Beachy. 1993. Genetically engineered protection against viruses in transgenic plants. Annu. Rev. Microbiol. 47: 739-763.

Hammond, J. and K.K. Kamo. 1993. Transgenic coat protein and antisense RNA resistance to bean yellow mosaic potyvirus. Acta Hort. 336: 171-178.

Hefferon, K.L., H. Khalilian, and M.G. AbouHaidar. 1997. Expression of the PVY^O coat protein (CP) under the control of the PVX CP gene leader sequence: protection under greenhouse and field conditions against PVY^O and PVY^N infection in three potato cultivars. Theor. Appl. Genet. 94: 287-292.

Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T-4. Nature 227: 680-685.

Lindbo, J.A. and W.G. Dougherty. 1992. Pathogen-derived resistance to a potyvirus: immune and resistant phenotypes in transgenic tobacco expressing altered forms of a potyvirus coat protein nucleotide sequence. Mol. Plant-Microbe Interact. 5: 144-153.

Ling, K., S. Namba, C. Gonsalves, J.L. Slightom, and D. Gonsalves. 1991. Protection against detrimental effects of potyvirus infection in transgenic tobacco plants expressing the papaya ringspot virus coat protein gene. Bio/Technology 9: 752-758.

Maiti, I.B., J.F. Murphy, J.G. Shaw, and A.G. Hunt. 1993. Plants that express a potyvirus proteinase gene are resistant to virus infection. Proc. Natl. Acad. Sci. USA 90: 6110-6114.

Mettler, I.J., W.R. Center, and S.C. Co. 1987. A simple and rapid method for minipreparation of DNA from tissue cultured plant cells. Plant Mol. Biol. Rep. 5: 346-349.

Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15: 473-497.

Namba, S., K. Ling, C. Gonsalves, J.L. Slightom, and D. Gonsalves. 1992. Protection of transgenic plants expressing the coat protein gene of watermelon mosaic virus II or zucchini yellow mosaic virus against six potyviruses. Phytopathology 82: 940-946.

Nejidat, A. and R.N. Beachy. 1990. Transgenic tobacco plants expressing a coat protein gene of tobacco mosaic virus are resistant to some other tobamoviruses. Mol. Plant-Microbe Interact. 3: 247-251.

Botanical Bulletin of Academia Sinica, Vol. 41, 2000

¨ã³Æ¤£¦P«e¾É§Ç¦C¤ì¥Ê½üÂI¯f¬rÀT³J¥Õ°ò¦]¤§

Âà°ò¦]µÒ¯ó¤§ºc¿v¤Î¨ä§Ü¯f¤ÀªR

¾GÄå¼z¹ ¸­¿üªF²

¹ »OÆW¹A·~¸ÕÅç©Ò¶éÃÀ¨t
² °ê¥ß¤¤¿³¤j¾Ç´Óª«¯f²z¾Ç¬ã¨s©Ò

¤ì¥Ê½üÂI¯f¬r YK ¨t²Î¬°¤ÀÂ÷¦Û¥x«n¿¤¥Ã±d¶m¤§ÄY­«´O¯¾«¬¯f¬r¨t²Î¡A¨ä°ò¦]Åé¤w³Q¿ï´Þ¤Î¸Ñ§Ç§¹ ¦¨¡C¦¹¯f¬r¤§ÀT³J¥Õ°ò¦]¤Î 3' «DÂàĶ°Ï§Q¥Î©wÂI¬ðÅÜ«á±µ©ó gus °ò¦]«e¾É§Ç¦C¡Aºc¿v¦¨½èÅé pGGCP¡C½èÅé pG5'CP ¬° pGGCP ¤W¤§ gus °ò¦]«e¾É§Ç¦C³Q PRSV ¤§ 5' ¤ù¬q¡]nt 1-347¡A¦¹¤ù¬q§t P₁ ³J¥Õ N ºÝ¤§ 9 kDa ³¡¤À¡^¨ú¥N«á¤§¸üÅé¡CpGGCP ©M pG5'CP ¦b¥ÍÅé¥~Âà¿ý¤ÎÂàĶ¤ÀªR¤¤¡A¤À§O²£¥Í¥i»P PRSV ¤§§Ü¦å²M¤ÏÀ³¤§ 36 kDa »P 45 kDa ³J¥Õ¡A¦Ó¥H«eªÌ²£¥Í¤§¶q¸û«áªÌ¬°¦h¡C¦¹¤Gºc¿v¤§ PRSV ÀT³J¥Õ°ò¦]¤À§O§Q¥Î¹A±ìµß´C¤¶Âà´Þ¦ÜµÒ¯ó´Ó®è¡]Nicotiana tabacum L. Havana 423¡^¡AÂà°ò¦]µÒ¯ó§Q¥Î¦è¤èº{¬Vªk¥i°»´ú¨ìªí²{¨}¦n¤§ 36 kDa ³J¥Õ©Î¸û·L¶q¤§ 45 kDa ³J¥Õ¡C§Q¥Î»E¦XüijsÂê¤ÏÀ³¥i°»´ú¨ì CP °ò¦]¦s¦b©óµÒ¯ó¤§¤¤¡C¤ÀªR¤K­ÓÂà°ò¦]®è¨t¤§¤l¥N¡A¨ä¤ÀÂ÷¤ñÅã¥Ü CP °ò¦]§¡¥H³æ¤@Åã©Ê°ò¦]§Î¦¡¦s¦bµÒ¯ó¬V¦âÅé¡C¥|­Ó§t¦³ gus °ò¦]«e¾É§Ç¦C¤Î¥|­Ó§t¦³ PRSV 5' «e¾É§Ç¦C¤§ÀT³J¥ÕÂà°ò¦]µÒ¯ó¤§ R₀ ¤Î R₁ ¥@¥N´Ó®è¸g¥H TEV¡BPVY ¤Î PepMoV ¬D¾Ô±µºØ¡AÂà°ò¦]´Ó®è©úÅ㩵½w¯f¼x¤§ªí²{¤Î´î»´¯f¼x¤§ÄY­«µ{«×¡A¦ý§t¦³ gus °ò¦]«e¾É§Ç¦C¤§Âà°ò¦]µÒ¯ó¤§§Ü©ÊÀu©ó PRSV 5' «e¾É§Ç¦C¤§Âà°ò¦]µÒ¯ó¡A¦¹Åã¥Ü PRSV ¤§«e¾É§Ç¦C¨Ã¥¼¯à¼W¥[§Ü¯f©Ê¡C

ÃöÁäµü¡G¤ì¥Ê½üÂI¯f¬r¡FÀT³J¥Õ°ò¦]¡F°¨¹aÁ¦ Y ¸s¯f¬r¡FÂàĶ«e¾É§Ç¦C¡C