Bot. Bull. Acad. Sin. (2001) 42: 85-92

Chang et al. — Rice class I LMM HSP gene, Oshsp16.9C

Isolation and characterization of the third gene encoding a
16.9 kDa class I low-molecular-mass heat shock protein, Oshsp
16.9C, in rice

Pi-Fang Linda Chang^1,3, Chung-Yi Huang^2,3, Fa-Cheng Chang^{2, 4}, Tong-Seung Tseng^{2, 5}, Wan-Chi Lin^{2, 6}, and Chu-Yung Lin^2,*

¹Department of Plant Pathology, National Chung Hsing University, Taichung, Taiwan 402, Republic of China

²Department of Botany, National Taiwan University, Taipei, Taiwan 106, Republic of China

(Received May 1, 2000; Accepted September 6, 2000)

Abstract. Using rice cDNA pTS1 encoding a 16.9 kDa heat shock protein (HSP) as a probe for Southern hybridization analysis, we observed five prominent bands of 9.5, 5.9, 3.4, 2.5, and 1.7 kb in the Eco RI digests of rice genomic DNA and found them to contain six individual genes. The 5.9 kb DNA fragment was further digested with Hind III to generate three fragments of 3.5, 1.7 and 0.7 kb, and we found, using pTS1 cDNA as a probe, the 3.5 kb fragment contained a putative low-molecular-mass (LMM) HSP gene. The DNA sequencing of 3.5 kb fragment revealed encoding of a presumptive 16.9 kDa HSP (149 amino acid residues) with predicted pI value of 6.42. The nucleotide sequence of this gene was highly homologous to the coding regions of two rice class I LMM HSP genes, Oshsp 16.9A and Oshsp16.9B, sharing 93.1% and 94.3% sequence identity, respectively, as published previously in our laboratory. The deduced amino acid sequence of this gene is similar to those of the Oshsp16.9A and Oshsp16.9B genes with a difference of only 11 and 10 amino acids, respectively. It was hence designated as Oshsp16.9C (accession no. U81385). We used 3' UTRs (untranslated regions) for analysis of Oshsp16.9C gene expression since the 3' UTRs of these three genes showed very low sequence homology.

Keywords: Heat shock protein; Heat shock gene; Low-molecular-mass heat shock protein; Oryza sativa L.

Abbreviations: HS, heat shock; HSP, heat shock protein; LMM, low-molecular-mass; UTR, untranslated region.

Introduction

Heat shock proteins (HSPs) have been induced during thermal stress in all organisms ever examined, ranging from bacteria to human beings (Schlesinger et al., 1982), and they appear to be involved in thermoprotection (Lin et al., 1984; Chou et al., 1989; Krishnan et al., 1989; Vierling, 1991; Jinn et al., 1997). The HSPs are usually divided into high-molecular-mass (HMM) proteins of more than 30 kDa and low-molecular-mass (LMM) proteins of about 17 to 28 kDa (Lindquist and Craig, 1988; Vierling, 1991). In contrast to animal systems, plants synthesize more abundant LMM HSPs than HMM HSPs. The LMM HSPs superfamily is unusually complex, consisting of at least five gene families (LaFayette et al., 1996; Waters et al., 1996). The role

of LMM HSP in heat stress is not completely clear yet. However, the sequence conservation of genomic and cDNA clones of plant LMM HSP genes isolated and characterized from a number of species suggests that they may play an important role in plants coping with HS.

We have been studying the physiological function of class I LMM HSPs in soybean and rice (Lin et al., 1984; Chou et al., 1989; Jinn et al., 1989; Jinn et al., 1993; Jinn et al., 1995; Yeh et al., 1995; Jinn et al., 1997; Yeh et al., 1997). We have isolated and characterized three cDNA clones: pTS1 (encoding a 16.9 kDa HSP, Tseng et al., 1992), pTS3 (encoding a 17.3 kDa HSP, Tseng et al., 1992), and pYL (encoding a 18.0 kDa HSP, Lee et al., 1995), and also five genomic clones, Oshsp16.9A, Oshsp16.9B, Oshsp18.0, Oshsp17.3, and Oshsp17.7 of rice class I LMM HSPs (Tzeng et al., 1992; 1993; Guan et al., 1998, respectively). The Oshsp16.9A contains the sequence of pTS1 cDNA. The three cDNA clones are highly homologous in their sequences except for the 3' untranslated regions (UTRs), which show a low degree of homology. Because of the abundance and complexity of these proteins, we have tried to isolate and characterize additional genes for rice class I LMM HSPs for the purpose of studying their differences in gene expression under heat stress. So far, we have isolated and characterized all the genes for rice class I LMM

³Equally contributed.

⁴Present address: Center of Genetic Engineering, National Chung Hsing University, Taichung, Taiwan 402, Republic of China.

⁵Present address: Department of Plant Biology, University of Minnesota, St. Paul, MN 55108-1095, USA.

⁶Present address: Institute of Bioagricultural Sciences, Academia Sinica, Taipei, Taiwan 115, Republic of China.

*Corresponding author. Tel: 886-2-2363-0231 ext. 2675; Fax: 886-2-2363-8598; E-mail: chuyung@ccms.ntu.edu.tw

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

tion of suitable enzymes located in the multiple cloning sites of the vector. For this 5.9 kb clone, nested deletion sets were generated using the Erase-a-Base System (Promega, Madison, WI, USA) according to the manufacturer's protocol and DNA sequences were determined using the Sequenase Version 2.0 DNA Sequencing Kit (USB, Cleveland, OH, USA).

Preparation of the 3' UTRs of pTS3 and pYL cDNAs and Oshsp16.9C

The 3' UTRs of pTS3, pYL, and Oshsp16.9C were prepared by polymerase chain reaction (PCR) using the PCR kit (Perkin Elmer Centus, Norwalk, CT, USA). The primers for PCR were 5' AGCATTGGGCTAATCT 3' (the 5' end primer) and 5' ACAACAGGTTTTACCG 3' (the 3' end primer) for pTS3, 5' AGAAACTTCGGGTGTG 3' (the 5' end primer) and 5' TCACTTCCAACATAGC 3' (the 3' end primer) for pYL, and 5' GAAGGAGAGAAGCTATATAC 3' (the 5' end primer) and 5' TAGCTCATTCATTCAGACTC 3' (the 3' end primer) for Oshsp16.9C. The PCR reactions for pTS3 and pYL were 40 sec at 94°C, 40 sec at 50°C, 40 sec at 72°C for 32 cycles; and that for Oshsp16.9C was 30 sec at 94°C, 30 sec at 42°C, 30 sec at 72°C for 35 cycles followed by 10 min at 72°C for 1 cycle. The PCR products were gel-purified, ligated into a pGEM-7Zf(+) vector, confirmed by sequencing, and used for labeling as probes. The lengths of PCR products were 158 bp, 141 bp and 187 bp for 3' UTRs of pTS3, pYL, and Oshsp16.9C, respectively.

RNA Isolation and Northern Blot Analysis

Total RNA was isolated from control and heat-shocked 3-day-old rice seedlings according to Chang et al. (1993). RNA samples were separated on 1.2% formaldehyde agarose gels and transferred to Hybond-C extra membranes (Amersham, Buckinghamshire, UK) as described by Sambrook et al. (1989). Filters were prehybridized in 50% formamide/5X SSC/0.1% SDS/20 mM Na phosphate pH 6.5/0.1% Ficoll/0.1% PVP/250 mg ml^-1 denatured salmon sperm DNA at 42°C for 4-6 h followed by hybridization at 42°C for overnight in prehybridization solution with ³²P-labeled probes (~5 × 10⁶ cpm). The 3' UTR of Oshsp16.9C was labeled with (a-³²P) dCTP (1000 Ci mmol^-1, Amersham, Buckinghamshire, UK) for a probe using the Prime-a-Gene Labeling System (Promega, Madison, WI, USA). Filters were then washed three times in 2X SSC/0.1% SDS at room temperature for 10 min with final washes in 0.1X SSC/0.1% SDS twice at 53°C for 30 min.

Primer Extension Analysis

Poly (A)⁺ RNA was purified from total RNA isolated from heat-shocked 3-day-old rice seedlings by oligo (dT) cellulose chromatography (Zurfluh and Guilfoyle, 1982). Ten pmole of the oligonucleotide 5'-tgttggtttgtcgtgatc-3', which is complementary to 65-82 bases downstream from the TATA sequence of the Oshsp16.9C gene, was labeled at the 5' terminus with (g-³²P) ATP (3000 Ci mmol^-1,

HSPs in our laboratory by use of pTS1 cDNA as a probe. Here we report the nucleotide sequence and deduced amino acid sequence of a third rice gene, which encodes a protein product of about 16.9 kDa and was designated as Oshsp16.9C.

Materials and Methods

Plant Materials and Treatments

Rice (Oryza sativa L. cv. Tainong 67) seedlings were germinated in darkness at 28°C for 3 days in rolls of moist paper towels as described by Lin et al. (1984). Three-day-old rice seedlings without endosperms were incubated in a medium containing 5 mM potassium phosphate (pH 6.0) and 1% sucrose before treatment at control (28°C) or heat-shocked (41°C) temperatures for 2 h. Seedlings were harvested, frozen in liquid N₂ and ground to a fine powder with a mortar and pestle. The powders were subjected to DNA or RNA isolation as described below.

DNA Isolation and Southern Blot Analysis

Total rice DNA was isolated according to Malmberg et al. (1985). DNA was digested with Eco RI and Hind III restriction enzymes, separated on 1% agarose gels and transferred to Hybond-C extra membranes (Amersham, Buckinghamshire, UK). Filters were prehybridized in 50% formamide/5X SSC/0.1% SDS/20 mM Na phosphate pH 6.5/0.1% Ficoll/0.1% PVP/250 mg ml^-1 denatured salmon sperm DNA at 42°C for 4-6 h followed by hybridization at 42°C overnight in prehybridization solution with ³²P-labeled probes (~5 × 10⁷ cpm). The coding region of pTS1, 3' UTRs of pTS3, pYL, and Oshsp16.9C were labeled with (a-³²P) dCTP (1000 Ci mmol^-1, Amersham, Buckinghamshire, UK) for probes using the Prime-a-Gene Labeling System (Promega, Madison, WI, USA). Filters were then washed three times in 2X SSC/0.1% SDS at room temperature for 10 min with final washes in 0.1X SSC/0.1% SDS twice at 53°C for 30 min.

Construction and Screening of Size-Selected Genomic Library

Total rice genomic DNA was digested with Eco RI restriction enzyme. The DNA sizes between 5 and 7 kb were eluted and further ligated to the Eco RI site of lEMBL-3 vector (Promega, Madison, WI, USA) for library construction according to the standard methods (Sambrook et al., 1989). The size-selected genomic libraries (~10⁵ plaques) were screened with rice pTS1 probe under the same conditions described in DNA Isolation and Southern Blot Analysis. Positive plaques were identified by autoradiography.

Restriction Mapping, Subcloning and Sequencing of the Positive Clones

One positive clone (5.9 kb) was isolated and subcloned into a pGEM-3Zf(+) vector. The restriction map was determined using different combinations of restriction diges

Chang et al. — Rice class I LMM HSP gene, Oshsp16.9C

Amersham, Buckinghamshire, UK) and T4 polynucleotide kinase using the Primer Extension System (Promega, Madison, WI, USA). One µg of the poly (A)⁺ RNA samples were annealed with 1 pmole of the labeled primer for primer extension reaction according to the manufacturer's protocol. Primer extension products were electrophoresed in parallel with the sequencing reaction, which had been primed with the same oligonucleotide.

Results and Discussion

Isolation of a 5.9 kb Genomic Clone Encoding a Putative Rice Class I LMM HSP

Five prominent bands of 9.5, 5.9, 3.4, 2.5, and 1.7 kb in the Eco RI digests of rice genomic DNA were observed by Southern hybridization analysis using rice pTS1 cDNA, encoding a 16.9 kDa HSP, as a probe (Tzeng et al., 1993). The 3.4 and 2.5 kb fragments have been shown to contain two rice HSP genes: Oshsp16.9B and Oshsp16.9A, respectively (Tzeng et al., 1993). In order to isolate other genes of rice class I LMM HSPs for expression analysis, the same probe was used to screen a size-selected rice genomic library established in lEMBL-3 vector. A 5.9 kb Eco RI fragment from the positive clone was isolated and subcloned into a pGEM-3Zf(+) vector. The 5.9 kb DNA

fragment could be further digested with Hind III to generate three fragments of 3.5, 1.7 and 0.7 kb, and we found the 3.5 kb fragment contained a putative class I LMM HSP gene as observed by Southern hybridization with pTS1 cDNA (Figure 1). The restriction map of the 5.9 kb fragment was determined, as shown in Figure 1C, to contain two Xbal I sites, one Sac I site, one Xho I site, one Bgl II 1site, and two Hind III sites.

Identification of a New Gene Encoding a Putative Rice Class I HSP

The sequences of three cDNA clones—pTS1 (encoding 16.9 kDa HSP), pTS3 (encoding 17.3 kDa HSP), and pYL (encoding 18.0 kDa HSP)—of rice class I LMM HSP are highly homologous in their coding regions. However, the 3' UTRs show a low degree of homology. Thus, we used the 3' UTRs of pTS3 and pYL cDNAs as probes to identified the possible corresponding genes, since the Oshsp16.9A has been shown to contain the pTS1 cDNA (Tzeng et al., 1993). The results of Southern blot analysis suggested that the 5.9 kb fragment was not recognized by either the 3' UTRs of pTS3 or pYL (data not shown); hence, this 5.9 kb fragment contained a new gene of putative rice class I LMM HSP which has not been characterized before.

Figure 1. Southern blot analysis of rice 5.9 kb DNA fragment probed with the coding region of pTS1 cDNA and the restriction map of the rice 5.9 kb Eco RI fragment. The clone of rice 5.9 kb Eco RI fragment in pGEM-3Zf(+) vector was digested with Eco RI (E), Bgl II (B), Hind III (H), Sac I (S), Xba I (Xb), Xho I (Xh) or subjected to double digestion with Bgl II and Eco RI (BE), Hind III and Eco RI (HE), Xba I and Eco RI (XbE), Xho I and Eco RI (XhE), or Sac I and Eco RI (SE). Panel A: ethidium bromide staining; Panel B: Southern blot analysis; Panel C: restriction map of the rice 5.9 kb Eco RI fragment. The molecular mass markers (M) are shown and indicated.

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

amino acids. The deduced amino acid sequence of Oshsp16.9C is identical to those of the Oshsp16.9A and Oshsp16.9B genes with a difference of only 11 and 10 amino acids, respectively (Figure 3B). Within the class I LMM HSPs in general, there is a high degree of sequence conservation in the carboxyl-terminal portion of the proteins while the amino-terminal shows significantly less (Vierling, 1991). The deduced amino acid sequence alignment of Oshsp16.9A, Oshsp16.9B, and Oshsp16.9C genes, as shown in Figure 3B, showed that only two or three out of 100 amino acids were different in the carboxyl-terminal, whereas, eight out of 50 amino acids were different in the amino-terminal.

Figure 2. DNA sequence and corresponding amino acid sequence of the rice gene Oshsp16.9C. The sequence of coding region is capitalized. Arrow indicates site of transcriptional initiation (-86). HSE-like sequences are underlined. A/T-runs are in boldface. Polyadenylation signal and putative TATA box are designated by dashed lines. The GenBank accession number is U81385 for Oshsp16.9C.

Sequence Analysis and Characterization of the Putative Rice HSP Gene

The 5.9 kb fragment cloned into a pGEM-3Zf(+) vector was subjected to sequencing. The DNA sequence between the Eco RI site and Xba I site (as shown in Figure 2) of this fragment revealed an open reading frame predicted to encode a polypeptide of 16.9 kDa (149 amino acid residues) with a pI value of 6.4 and was hence designated as Oshsp16.9C. The GenBank accession number is U81385 for Oshsp16.9C. The coding region of Oshsp16.9C was compared with those of Oshsp16.9A and Oshsp16.9B as shown in Figure 3. The base composition in the coding region of the Oshsp16.9C gene is 20.44% of A, 35.33% of G, 14.00% of T, and 30.22% of C. No intron is present in the Oshsp16.9C gene, just as in the Oshsp16.9A, Oshsp 16.9B genes and other class I LMM HSP genes of rice. According to the results of nucleotide sequence comparison (Figure 3A), Oshsp16.9C shares 93.1% and 94.3% identity with Oshsp16.9A and Oshsp16.9B, respectively, in their coding regions. The composition of 149 amino acid residues deduced from the coding sequence of Oshsp 16.9C is 25 strong basic (+) amino acids, 26 strong acidic (-) amino acids, 52 hydrophobic amino acids, and 26 polar

Figure 3. Comparison of DNA and deduced amino acid sequences of three rice HSP genes Oshsp16.9A, Oshsp16.9B, and Oshsp16.9C. DNA (A) and deduced amino acid (B) sequences of Oshsp16.9C compared with those of two other rice genes for 16.9 kDa HSP, Oshsp16.9A (M80938) and Oshsp16.9B (M80939) reported by Tzeng et al. (1992). Dashes indicate insertions or deletions to allow for maximal alignment, and stars («) indicate sequence difference.

Chang et al. — Rice class I LMM HSP gene, Oshsp16.9C

The 5' upstream sequence obtained was about 932 bp (as shown in Figure 2), which contained a putative TATA box (TATAAATA), 142-base upstream from the initiation codon ATG, and multiple copies of HS consensus elements (HSEs) upstream from the TATA box. The initiation site of transcription of Oshsp16.9C, identified by the primer extension method, was located 86 bases upstream (-86) from the deduced start of translation and 56 bases downstream from the TATA box (Figure 4). The weak band was seen above the major band (Figure 4), which might have resulted from the cross-hybridization of RNA transcribed from closely related genes encoding HSPs in the same LMM class (Czarnecka et al., 1985; Tzeng

et al., 1993). There were tandem overlapping HSEs, (from -19 to -48) proximal to the TATA box, a typical feature of class I LMM HSP genes (Nagao and Key, 1989; Schöffl et al., 1998). Among these HSEs, 5 to 9 out of 10 nucleotides matched the HS consensus, CTnGAAnnTTCnAG, as defined by Pelham (1985). The arrangement of HSEs on the 5' upstream sequence of Oshsp16.9C was compared with those of Oshsp16.9A and Oshsp16.9B (Figure 5). There are 8 HSEs in the upstream region of both the Oshsp16.9A and Oshsp16.9B genes, but there are 20 in that of Oshsp16.9C. Some HSEs even locate downstream the TATA box and transcription initiation site of the Oshsp16.9C, but whether these HSEs are required for heat

Figure 4. Identification of the site of transcription initiation for Oshsp16.9C by the primer extension method. Lane PE shows the primer extension products of HS. Lanes G, A, T, C are from a DNA sequencing reaction in which the same primer was used. The transcription initiation site is indicated by an arrowhead with a star («).

Figure 6. Northern blot analysis of rice RNA probed with the 3' UTR of Oshsp16.9C. Total RNA (15 µg per lane) isolated from 3-day-old rice seedlings after 2 h of 28°C (C) or 41°C (H) treatments were subjected to Northern blot analysis.

Figure 5. The arrangement of HSEs on the 5' upstream sequences of Oshsp16.9A, Oshsp16.9B, and Oshsp16.9C. Schematic alignment of about 930 nucleotides (lines) upstream from the coding regions of three rice HSP genes, Oshsp16.9A, Oshsp16.9B, and Oshsp16.9C, relative to their TATA boxes (TATAAATA, as indicated). The sites of transcriptional initiation are indicated by filled triangle. Putative HSEs (CTnGAAnnTTCnAG) are indicated as boxes. Number in parenthesis indicates position relative to the first ATG. All sequence elements and their spacing are drawn to scale.

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

Acknowledgements. This work was supported by National Science Council, Taiwan, ROC. under Grants NSC84-2311-B-002-007 B01 and NSC85-2311-B-002-010 B13 to C.-Y. L.

Literature Cited

Baumann, G., E. Raschke, M. Bevan, and F. Schöffl. 1987. Functional analysis of sequence required for transcriptional activation of a soybean heat shock gene in transgenic tobacco plants. EMBO J. 6: 1161-1166.

Chang, P.-F.L., M.L. Narasimhan, P.M. Hasegawa, and R.A. Bressan. 1993. Quantitative mRNA-PCR for expression analysis of low-abundance transcripts. Plant Mol. Biol. Rep. 11: 237-248.

Chou, M., Y.M. Chen, and C.Y. Lin. 1989. Thermotolerance of isolated mitochondria associated with heat shock proteins. Plant Physiol. 89: 617-621.

Czarnecka, E., P.C. Fox, and W.B. Gurley. 1990. In vivo interaction of nuclear proteins with the promoter of soybean heat shock gene Gmhsp 17.5E. Plant Physiol. 94: 935-943.

Czarnecka, E., W.B. Gurley, R.T. Nagao, L.A. Mosquera, and J.L. Key. 1985. DNA sequence and transcript mapping of a soybean gene encoding a small heat shock protein. Proc. Natl. Acad. Sci. USA 82: 3726-3730.

Czarnecka, E., J.L. Key, and W.B. Gurley. 1989. Regulatory domains of the Gmhsp 17.5-E heat shock promoter of soybean. Mol. Cell Biol. 9: 3457-3463.

Guan, J.C., F.C. Chang, T.S. Tseng, P.-F.L. Chang, K.W. Yeh, Y.M. Chen, and C.Y. Lin. 1998. Structure of rice genes encoding three class-I low-molecular-mass heat-shock proteins (accession nos. U83669, U83670, U83671) (PGR 98-178). Plant Physiol. 118: 1101.

Jinn, T.-L., P.-F.L. Chang, Y.M. Chen, J.L. Key, and C.Y. Lin. 1997. Tissue-type-specific heat-shock response and immunolocalization of class I low-molecular-weight heat-shock proteins in soybean. Plant Physiol. 114: 429-438.

Jinn, T.L., Y.M. Chen, and C.Y. Lin. 1995. Characterization and physiological function of class I low-molecular-mass heat-shock protein complex in soybean. Plant Physiol. 108: 693-701.

Jinn, T.-L., S.-H. Wu, C.-H. Yeh, M.-H. Hsieh, Y.-C. Yeh, Y.-M. Chen, and C.-Y. Lin. 1993. Immunological kinship of class I low molecular weight heat shock proteins and thermostabilization of soluble proteins in vitro among plants. Plant Cell Physiol. 34: 1055-1062.

Jinn, T.-L., Y.-C. Yeh, Y.-M. Chen, and C.-Y. Lin. 1989. Stabilization of soluble proteins in vitro by heat shock proteins-enriched ammonium sulfate fraction from soybean seedlings. Plant Cell Physiol. 30: 463-469.

Krishnan, M., H.T. Nguyen, and J.J. Burke. 1989. Heat shock protein synthesis and thermal tolerance in wheat. Plant Physiol. 90: 140-145.

LaFayette, P.R., R.T. Nagao, K. O'Grady, E. Vierling, and J.L. Key. 1996. Molecular characterization of cDNAs encoding low-molecular-weight heat shock proteins of soybean organelles. Plant Mol. Biol. 30: 159-169.

Lee, Y.-L., P.-F.L. Chang, K.-W. Yeh, T.-L. Jinn, C.-C.S. Kung, W.-C. Lin, Y.-M. Chen, and C.-Y. Lin. 1995. Cloning and characterization of a cDNA encoding an 18.0-kDa class-I low-molecular-weight heat-shock protein from rice. Gene 165: 223-227.

inducible transcription of the native gene as suggested by Baumann et al. (1987) remains to be tested. Sequences other than the TATA-proximal HSEs have also been shown to be required for full expression of the promoter in plant HS genes (Czarnecka et al., 1989).

Further upstream from the putative promoter regions, the Oshsp16.9C gene contains a DNA sequence very rich in A+T (54.01% compared to only 34.44% within the coding region) starting with runs of "simple sequences" such as (A)₉, (A)₇, (A)₅ and (T)₅ at nucleotide position -441, -522, -886, and -903 (Figure 4). Runs of "simple sequences" (A)_n, (T)_n or (AT)_n have been observed in most HS promoters in soybean (Raschke et al., 1988). Czarnecka et al. (1990) demonstrated a binding of nuclear proteins to scattered AT-rich sequences of soybean Gmhsp 17.5-E gene promoter. Such sequences possibly contribute to the transcriptional regulation of HS genes. The significance of these upstream elements in gene regulation is being studied in our laboratory using the PCR technique to amplify different DNA fragments.

Although the sequence of Oshsp16.9C is highly homologous to those of the Oshsp16.9A and Oshsp16.9B in their coding regions, the 3' UTRs of these three genes show very low sequence homology. The sequence similarity between the 3' UTRs of Oshsp16.9A and Oshsp 16.9B, Oshsp16.9A and Oshsp16.9C, and Oshsp16.9B and Oshsp16.9C are 53.33%, 45.46% and 53.28%, respectively. Since the homology of 3' UTRs in Oshsp16.9A, Oshsp 16.9B and Oshsp16.9C are low, we could use these 3' UTR fragments as probes for gene expression studies. The role of 3' UTR in affecting gene expression remains to be determined. However, the effect of the 3' UTR in two hsp70-adh cDNA gene chimeras was examimed (Yost et al., 1990). Both constructs were driven by the hsp70 promoter and contained the adh coding region. They differed in having either the adh 3' UTR or the hsp70 3' UTR. While transcripts with the adh 3' UTR were very stable during recovery from HS, transcripts with the hsp70 3' UTR were unstable, and decayed in a manner similar to the endogeneous hsp70 transcripts. Thus, the 3'UTR of the hsp70 message plays a critical role in regulating its degradation (Yost et al., 1990). The putative polyadenylation signal AATAAA was located between +635 and +640 in Oshsp16.9C (Figure 2). This signal was located between +791 and +796 in Oshsp16.9A and between +737 and +742 in Oshsp16.9B (Tzeng et al., 1993).

Expression of the Oshsp16.9C Gene

The 3' UTR of Oshsp16.9C was obtained by PCR as described in Materials and Methods. It was used as a probe to analyze the expression of the Oshsp16.9C gene. The results of Northern blot hybridization suggest that this gene is expressed in heat-shocked (41°C, 2 h), but not in control (28°C, 2 h), seedlings (Figure 6). It is clear the Oshsp16.9C gene is activated by HS with a transcript of about 900 nucleotides in length. Activation of this gene under different HS or stress conditions in comparison with Oshsp16.9A and Oshsp16.9B will be further studied.

Chang et al. — Rice class I LMM HSP gene, Oshsp16.9C

Lin, C.Y., J.K. Roberts, and J.L. Key. 1984. Acquisition of thermotolerance in soybean seedlings: synthesis and accumulation of heat shock proteins and their cellular localization. Plant Physiol. 74: 152-160.

Lindquist, S. and E.A. Craig. 1988. The heat-shock proteins. Annu. Rev. Genet. 22: 631-677.

Malmberg, R., J. Messing, and I. Sussex. 1985. Molecular Biology of Plants: a Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Nagao, R.T. and J.L. Key. 1989. Heat shock protein genes of plants. In J. Schell and I. Vasil (eds.), Cell Culture and Somatic Cell Genetics of Plants, vol. 6. Molecular Biology of Plant Nuclear Genes. Academic Press, San Diego, pp. 297-328.

Pelham, H.R.B. 1985. Activation of heat-shock genes in eukaryotes. Trends Genet. 1: 31-35.

Raschke, E., G. Baumann, and F. Schöffl. 1988. Nucleotide sequence analysis of soybean small heat shock protein genes belonging to two different multigene families. J. Mol. Biol. 199: 549-557.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Schlesinger, M.J., M. Ashburner, and A. Tissieres. 1982. Heat Shock: From Bacteria to Man, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Schöffl, F., R. Prändl, and A. Reindl. 1998. Regulation of the heat-shock response. Plant Physiol. 117: 1135-1141.

Tseng, T.S., S.S. Tzeng, K.W. Yeh, C.H. Yeh, F.C. Chang, Y.M. Chen, and C.Y. Lin. 1993. The heat-shock response in rice seedlings: isolation and expression of cDNAs that encode class I low-molecular-weight heat-shock proteins. Plant Cell Physiol. 34: 165-168.

Tseng, T.S., K.W. Yeh, C.H. Yeh, F.C. Chang, Y.M. Chen, and C.Y. Lin. 1992. Two rice (Oryza sativa) full-length cDNA clones encoding low-molecular-weight heat-shock proteins. Plant Mol. Biol. 18: 963-965.

Tzeng, S.S., Y.-M. Chen, and C.-Y. Lin. 1993. Isolation and characterization of genes encoding 16.9 kD heat shock proteins in Oryza sativa. Bot. Bull. Acad. Sin. 34: 133-142.

Tzeng, S.S., K.-W. Yeh, Y.-M. Chen, and C.-Y. Lin. 1992. Two Oryza sativa genomic DNA clones encoding 16.9-kilodalton heat-shock proteins. Plant Physiol. 99: 1723-1725.

Vierling, E. 1991. The roles of heat shock proteins in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42: 579-620.

Waters, E.R., G.J. Lee, and E. Vierling. 1996. Evolution, structure and function of the small heat shock proteins in plants. J. Exp. Bot. 47: 325-338.

Yeh, C.-H., P.-F.L. Chang, K.-W. Yeh, W.-C. Lin, Y.-M. Chen, and C.-Y. Lin. 1997. Expression of a gene encoding a 16.9-kDa heat-shock protein, Oshsp16.9, in Escherichia coli enhances thermotolerance. Proc. Natl. Acad. Sci. USA 94: 10967-10972.

Yeh, C.-H., K.-W. Yeh, S.-H. Wu, P.-F.L. Chang, Y.-M. Chen, and C.-Y. Lin. 1995. A recombinant rice 16.9-kDa heat shock protein can provide thermoprotection in vitro. Plant Cell Physiol. 36: 1341-1348.

Yost, H.J., R.B. Petersen, and S. Lindquist. 1990. RNA metabolism: strategies for regulation in the heat shock response. Trends Genet. 6: 223-227.

Zurfluh, L.L. and T.J. Guilfoyle. 1982. Auxin-induced changes in the population of translatable messenger RNA in elongating sections of soybean hypocotyls. Plant Physiol. 69: 332-337.

Botanical Bulletin of Academia Sinica, Vol. 42, 2001

¤ô½_¤¤²Ä¤T­Ó 16.9 kDa ²Ä¤@±Ú§C¤À¤l¶q¼ö¥ð§J³J¥Õ½è°ò¦]¡AOshsp16.9C¡A¤§¤ÀÂ÷»PŲ©w

±iºÑªÚ¹¶À¥ò¸q² ±iªk¥¿²´¿¥Vµ«²ªL°ûµa²ªL¬îºa²

¹ °ê¥ß¤¤¿³¤j¾Ç´Óª«¯f²z¾Ç¨t

² °ê¥ß¥xÆW¤j¾Ç´Óª«¾Ç¨t
§Q¥Î¤ô½_ 16.9 kDa ¼ö¥ð§J³J¥Õ½è (HSP) °ò¦]¤§ cDNA¡ApTS1¡A§@¬°«n¤è¾¥ÂI¤ÀªRªk¤§±´°w¡A¥i¦b ¥H Eco RI ­­¨î¤Á³Î¤§¤ô½_°ò¦]²Õ DNA ¼Ë«~¤¤¡A°»´ú¨ì¤­­Ó²M´·ªº±ø±a¡A¨ä¤j¤p¤À§O¬° 9.5¡B5.9¡B3.4¡B2.5 ¤Î 1.7 kb¡A¸g¹L¥»¬ã¨s«Ç¤§¤ÀªR¡A¨ä¤¤¥]§t¤»­Ó¤£¦Pªº°ò¦]¡C±N 5.9 kb ¤§ DNA ¤ù¬q¥H Hind III ­­¨î»Ã¯À§@¶i¤@¨B¤Á³Î¡A¥i±o 3.5¡B1.7 ¤Î 0.7 kb µ¥¤T­Ó±ø±a¡A¦A¥H pTS1 §@¬°±´°w±oª¾ 3.5 kb ¤ù¬q¤¤¥i¯à¥]§t¤@§C¤À¤l¶q¼ö¥ð§J³J¥Õ½è°ò¦]¡C¸g¥Ñ©w§Ç¤ÀªR¦¹ 3.5 kb ¤ù¬q¤§®Ö»Ä§Ç¦C¡A±À´ú¨ä¥i¯à¤§ÂàĶ²£ª« ¬°¥]§t 149 ­Ó®ò°ò»Ä¤§ 16.9 kDa ¼ö¥ð§J³J¥Õ½è¡A¨äµ¥¹qÂI (pI) ­È¦ô­p¬° 6.42¡C¦¹°ò¦]©M¥»¬ã¨s«Ç¤wµo ªíªº¤G­Ó¤ô½_²Ä¤@±Ú§C¤À¤l¶q¼ö¥ð§J³J¥Õ½è°ò¦]¡AOshsp16.9A ¤Î Oshsp16.9B¡A¦bÂàĶ°Ï¤º¤§®Ö»Ä§Ç¦C¨ã ¦³¬Û·í°ªªº¦P½è©Ê¡A¤À§O¦³ 93.1% ¤Î 94.3% ªº¬Û¦P«×¡C¦¹°ò¦]¤§®ò°ò»Ä±Àºt§Ç¦C©M Oshsp16.9A ¤Î Oshsp16.9B °ò¦]´X¥G§¹¥þ¬Û¦P¡A¤À§O¥u¦³ 11 ­Ó¤Î 10 ­Ó®ò°ò»Ä¤§¤£¦P¡A¦]¦¹±N¦¹°ò¦]©w¦W¬° Oshsp 16.9C (accession number: U81385)¡C¤wª¾¤ô½_²Ä¤@±Ú§C¤À¤l¶q¼ö¥ð§J³J¥Õ½è°ò¦]¤§ 3' «DÂàĶ°Ï (3' UTR) ªº®Ö»Ä§Ç¦C¬Û¦ü©Ê¸û§C¡A¦]¦¹§Ú­Ì±N Oshsp16.9C ¤§ 3' «DÂàĶ°Ï§@¬°±´°w¡A¥H¤ÀªR¨ä°ò¦]¤§ªí²{±¡§Î¡C

ÃöÁäµü¡G ¼ö¥ð§J³J¥Õ½è¡F¼ö¥ð§J°ò¦]¡F§C¤À¤l¶q¼ö¥ð§J³J¥Õ½è¡F¤ô½_¡C